AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                <-----------GT1
                                              <-------GAMYB
              <-------TEIL                   <---------MYB46(3)
             <------ZmHOX2a(2)             <---------ANAC58
            --------->GATA12               <---------ANAC46
            <---------ARR11(3)             <-------GAMYB
            <---------GATA12               <---------ANAC58              --------->HSFB2a(2)
            <---------ARR11(2)            <------MYB46(1)               ----------------->AG
            --------->ARR11(3)            --------->MYB55(2)       <---------ICU4
            --------->ARR11(2)            <------MYB83            <---------YAB5
            --------->AGP1                --------->MYB52(2)      <---------YAB1
   --------->LBD16                        <---------MYB46(3)    --------->YAB1        --------->At4g35610
  <---------LBD16       <---------RVE1(2)<---------AtMYB61      <---------ICU4 <---------GLK1(2)
 <---------LBD16  --------->YAB1        <---------MYB52(1)     <---------YAB5--------->DOF5.7(1)
---TOE1(3) <---------GLK1(1)          <-----------RAV1(1)    --------->YAB1---------->DOF2
---TOE2(3) --------->GLK1(1)      --------->ZAT18         <----------DOF2<---------HSFB2a(2) <------
 
ttttccctggagagagatccatgatcagagattggaggtcactgttggttgttaccagacgctttcatcatcatttccaaaagagtctcagccaaattca  1017700
                                    --------->AHL20(2)
                                 --------->YAB5
                                <---------YAB5
 <---------AHL12(1)             --------->ICU4   --------->PCF2
 --------->AHL12(1)        --------->YAB1        <---------ZAT18           <---------ZAT6
--------->AHL12(1)<---------AtMYB61 <---------KAN1               --------->REM1(1)            <-----
-TEIL<-----------GT1      <---------YAB1     --------->ALFIN1    --------->ANAC46   <-----------GT1
 
tgaaatttttgcaattttgttttggtttcattataaagattatatcaagttgggccctctctccctctacatcatctagtgtccatataaccagttggat  1017800
                                                                  <---------AHL12(2)
                                                                 <---------AHL12(1)
                                                                 --------->AHL12(1)
                                                                 --------->AHL12(3)
                                                                 <---------AHL12(2)
                                                                 <---------AHL20(2)
                                                                 <---------AHL12(3)
                                                                --------->AHL12(1)
                                                                <---------ARR11(3)
                                                                --------->ARR11(3)
                                                                <---------AHL12(1)
                                                                <---------AHL25(1)
                                                                --------->AHL25(1)
                                                                <---------AHL20(3)
                                                                <---------AHL25(3)
                                                                <---------AHL20(2)
                                                                --------->AHL25(2)
                                                                <---------AHL25(2)
                                                                --------->AHL20(2)
                                                                --------->AHL25(3)
                                                                --------->AHL20(3)
                     --------->GATA12                           --------->AHL20(1)
                     <---------GATA12                      --------->ANAC58     <---------GATA12
                --------->YAB1                  <---------ZAT14 <---------AHL20(1)           <------
               <---------YAB5                  <----------DOF2 <---------KAN1  --------->GLK1(1)
          <---------KAN1               <----------DOF2     --------->ANAC58    <---------GLK1(1)  <-
         --------------->AtSPL8   <-----------GT1    <-----------HVH21    ---------->DOF2    -------
----RVE1(2)  ------->TEIL    ----------->GT1  <---------DOF5.7(1)--------->AHL12(2)     ----------->GT1
 
tgtccaactcagaatgtactcataaatctgaattgttaaactcttttagtctttactgtcacacgaatatattttcagaaagaaatctgaattgtaaatc  1017900
                                                                        --------->AHL20(2)
                <----------DOF2                          --------->ARR11(3)
             --------->ARR11(3)             <---------GATA12            <---------AHL20(2)
            <---------GLK1(1)              <---------GLK1(1)          <---------WOX13(2)
     --------->ZAT18                       --------->GLK1(1)    <-----------GT1   ----------->GT1
 --------->MYB52(2)  --------->YAB1   ---------->DOF2    <---------ARR11(3)     ---------->DOF2  ---
---GATA12   <---------CCA1(2)     --------->DOF5.7(1)    --------->GATA12  ---------->DOF2    ------
---------DOF2<---------ARR11(3) ---------->DOF2     ----------->GT1   --------->WOX13(2)   <--------
-->GATA12   --------->GLK1(1)   --------->DOF5.7(1) --------->YAB1--------->TOE2(3)        ---------
 
tctttagttgcactgatatctttttcataaaaaaaaaaagagaaagaaatctgaatagtaaatcttttttcttaattaaaaagaaaagaaaaaacatctc  1018000
                                                         --------->AHL25(1)
                                                         <---------AHL20(2)            <---------ARR11(2)
                                                       --------->WOX13(2)            ----------->GT1
                              <<<<<<<<CAMTA3         --------->AHL20(2)              <---------MYB46(3)
                            --------->ANAC55(2)      <---------AHL20(2)            ------->MYC3
                            <---------ANAC55(2)    <---------WOX13(2)              <-------MYC3
                            --------->ANAC58       --------->WOX13(2)              <-------PIF5
                            --------->ANAC58      ----------->GT1                  ------->PIF5
                         ----------->HVH21    --------->ATHB12 ----------->GT1     ------->MYC2
    <---------ZAT14     <-----------HVH21<---------ANAC58--------->AHL20(2)        <-------MYC2
--->ZmHOX2a(1)         --------->ANAC46  <---------ANAC58<---------AHL25(1)       <---------ANAC46
--------->AGL15        --------->ANAC58 <---------ZAT18<---------WOX13(2)         <---------ANAC58
-ARR11(3)              --------->ANAC58 --------->ZAT18--------->AHL12(2)         <---------ANAC58*TSS
>ARR11(3)           <-------TEIL       --------->ALFIN1<---------AHL12(2)   <---------KAN1 <--------
 
cttatagtatagttgatagaaggtgcaagtcacgcgtttaatgtgcgcgtgattagttaattaaacttgtatatagagagtaagcgcgtggttacattgc  1018100
                                  ------>ZmHOX2a(2)
                        ------>ZmHOX2a(2)
                       --------->GLK1(1)
                       <------ZmHOX2a(2)
                      <---------ARR11(3)                        <---------MYB52(1)
                      --------->ARR11(3)                      <---------YAB1
                      --------->RVE1(2)                    <---------ARR11(2)
                      <---------GATA12                     --------->ARR11(2)                      -
                      --------->GATA12                     --------->ARR14(2)                      <
                      <---------AGP1                       <---------ARR14(2)                      <
             --------->TOE1(3)  --------->GATA12  --------->RVE1(2)                                -
            --------->ZAT6      <---------GATA12  --------->ARR14(2)                               -
      <---------ZAT6--------->DOF5.7(1)           <---------ARR14(2)                               -
--------->ZAT6    ---------->DOF2<---------GLK1(1)<---------GATA12           <----------DOF2    >>>>
----CBF  --------->KAN1<---------GLK1(1)          --------->GATA12     <----------DOF2        ------
 
aaaacactagagataaccctagaaagatctctctcgatctctggttcgaagaaaatccaccatttccgattgttctttctctttgacaaaacccagatag  1018200
                                   <---------ANAC46
                             --------->ARR14(2)
                             <---------ARR14(2)
                             --------->ARR11(2)
                             <---------ARR11(2)
                           --------->LBD16
    <-------TEIL          <---------HSFB2a(2)
 --------->AHL12(1)       --------->HSFB2a(2)
 --------->KAN1          <---------LBD16                                                      ------
-------->AHL20(3)     <---------GLK1(1)                                                       <-----
---------AHL20(3)     --------->ZAT2    ------>ZmHOX2a(1)                                  <--------
---------AHL12(3)     <---------At4g35610                                               <<<<<<<<<TBF1
-------->AHL12(3)     <---------ZAT2 <------NtERF2                                  --------->ICU4
-------->AHL25(1)     --------->At4g35610                                         --------->KAN1  --
-------->AHL12(2)   --------->ZAT14<---------ANAC58                              <---------MYB52(1)
>>>>>GATA-1         <---------ZAT18<---------ANAC58                             --------->LBD16 <---
----->GT1----------------->AGL1    <---------RAP2.6(2)                          --------->At5g28300
 
ataaaaattcgttccaattccagtgagctccggaaatggcgtccttcaagttgatgtcttcttccaattccgacttgtctcgccgtaattcttcttctgc  1018300
                                               --------->ANAC58
                                             <---------ALFIN1
                                            ------>ZmHOX2a(1)
                                        --------->ARR14(2)
                                        <---------GATA12
                                        --------->RVE1(2)
                                        <---------ARR11(2)
                                        --------->GATA12
                                        <---------ARR14(2)                                <---------DOF5.7(2)
                                        --------->ARR11(2)          <---------ARR14(2)   <---------WRKY12
                                       ------>MYB46(1)      --------->LBD16          <------ZmHOX2a(1)
                                  ------>NtERF2--------->ANAC46 <---------YAB5    --------->ATERF1(1)
                  =================================HOX2a_HOX2a --------->RVE1(2)  <------NtERF2
       <---------DOF5.7(1)       <---------ETT(1) --------->DEAR3(1)--------->ARR11(2)   <---------WRKY45
<---------At4g35610        <---------ALFIN1 ================HOX2a_HOX2a         <---------ANAC46
--->At4g35610     <------ZmHOX2a(2)    ------>MYB83     --------->ANAC46       <---------LBD16
----At4g35610    <---------ARR11(3)  --------->AtMYB61--------->YAB5--------->ARR14(2)   <---------WRKY38(1)
-At4g35610 --------->HSFB2a(2)   --------->DEAR3(1)  <------ZmHOX2a(2)      --------->SPL7(1)
------->REM1(1)  --------->ARR11(3)  <---------MYB59 <---------ATHB12      --------->MYB52(1)-------
-------DOF2<---------HSFB2a(2)--------->RVE1(2)--------->ANAC58--------->GLK1(2)<---------DEAR3(1)
 
ttcatcttccccttctataagatcatcgcaccatctccgaccaaatcctcacgccgatcactccagaatcagtttcgcttacggcggaggagtcaacgat  1018400
                                                                 --------->ARR11(2)
                                                              ------>ZmHOX2a(2)
                                                            --------->ARR14(2)
                                                            --------->GATA12
                                                            --------->ARR11(2)
                                                            <---------GATA12
                                                            <---------ARR14(2)
                                                            <---------ARR11(2)
                                                     <---------ARR14(2)
                                                     --------->ARR11(2)
                                                     --------->ARR14(2)
                                                     <---------ARR11(2)
                                                     --------->GLK1(2)
                                                     --------->MYB52(1)           ---------->DOF2
                                                     --------->RVE1(2)    <---------DOF5.7(2)
                                       <---------TOE2(3)   <---------GLK1(1) --------->MYB52(1)
                                       <---------RVE1(2)   --------->GLK1(1)--------->MYB46(3)    --
    <---------ANAC58                <---------WOX13(1) <---------ANAC46 --------->DOF5.7(2)      <--
    <---------ANAC58      <---------HSFB2a(2)  ------>ZmHOX2a(2) <---------ARR11(2) --------->DOF5.7(1)
 <----------DOF2          --------->HSFB2a(2)<---------GATA12<------ZmHOX2a(2)  ------->GAMYB<------
-->YAB5         ---------->DOF2    <-------GAMYB    <---------KAN1     --------->TOE2(3)--------->ALFIN1
 
tacactttcgcgtctgattcaaagcccttcgagatggcgattgatgttgatcggagtatcggagatcggaacagcgttaacaacggaaagagtgttgacg  1018500
                                         <---------REM1(1)
                                         <---------YAB1                        <------ZmHOX2a(1)
                                       --------->YAB5                        <---------TOE2(3)
                                       <---------ICU4                    --------->TGA1a
                 <---------LBD16      <---------YAB1                     <---------TGA1a
               <---------ARR11(2)     --------->ICU4                     <---------O2
               --------->ARR14(2)   --------->YAB1                       ===========================
               --------->ARR11(2)   <---------ICU4                --------->YAB1
      --------->DOF5.7(1)           --------->YAB5               <---------AHL20(2)           ------
    ---------->DOF2          --------->DOF5.7(1)  >>>>>>>>>TBF1--------->CCA1(2) --------->GLK1(1)<-
------->ATHB12 <---------ARR14(2)  <------ZmHOX2a(2)          <---------ARR11(3) <---------GLK1(1)<-
-------YAB1    ------->TEIL---------->DOF2  <---------TOE2(3) --------->ARR11(3)<---------ARR14(2)--
---TOE2(3)    <---------CCA1(2)   --------->ARR11(3) <---------ARR14(2)  --------->O2      ---------
 
atgtttggaaagagattgtatctggagagcaaaagacgatcatgatgaaggaagaagaaccagaagatataatgacacttgaggatttcttagcgaaagc  1018600
<- Previous    Next ->

AGI:  At1g03960.1   
Description:  calcium-binding EF hand family protein. similar to calcium-binding EF hand family protein [Arabidopsis thaliana] (TAIR:AT5G28900.1); similar to calcium-binding EF hand family protein, putative / protein phosphatase 2A 62 kDa B'' regulatory subunit, putative [Arabidopsis thaliana] (TAIR:AT5G44090.1); similar to calcium-binding EF hand family protein [Arabidopsis thaliana] (TAIR:AT5G28850.2); similar to putative protein phosphatase 2A regulatory subunit [Oryza sativa (japonica cultivar-group)] (GB:AAK13162.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40604.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65086.1)
Range:  from: 1013714    to: 1017928    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g03970.1   
Description:  GBF4 (G-box binding factor 4); transcription factor. Identical to G-box-binding factor 4 (GBF4) [Arabidopsis Thaliana] (GB:P42777); similar to bZIP transcription factor family protein [Arabidopsis thaliana] (TAIR:AT5G44080.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43627.1); contains InterPro domain bZIP transcription factor, bZIP-1; (InterPro:IPR011616); contains InterPro domain Basic-leucine zipper (bZIP) transcription factor; (InterPro:IPR004827)
Range:  from: 1018099    to: 1019246    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g03980.1   
Description:  ATPCS2 (PHYTOCHELATIN SYNTHASE 2); glutathione gamma-glutamylcysteinyltransferase. Identical to Glutathione gamma-glutamylcysteinyltransferase 2 (PCS2) [Arabidopsis Thaliana] (GB:Q9ZWB7); similar to CAD1 (CADMIUM SENSITIVE 1) [Arabidopsis thaliana] (TAIR:AT5G44070.1); similar to phytochelatin synthase [Thlaspi japonicum] (GB:BAB93119.1); similar to phytochelatin synthase 1 [Brassica juncea] (GB:BAB85602.1); similar to phytochelatin synthase [Thlaspi caerulescens] (GB:BAB93120.1); contains InterPro domain Phytochelatin synthase (InterPro:IPR007719); contains InterPro domain Phytochelatin synthase, C-terminal (InterPro:IPR015407)
Range:  from: 1018569    to: 1022107    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version