AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                  --------->ZAT18
                                                                  --------->ZAT14
                                                          --------->ALFIN1
                                                        <---------ANAC46         <------ZmHOX2a(2)
                                                        <---------ANAC58     <---------WOX13(1)
   --------->YAB1                                  --------->WOX13(2)      --------->ATHB12
  <---------YAB1                                  --------->ATHB12<---------ZAT14===============HOX2a_HOX2a
 <---------RVE1(2)                             <----------DOF2==========================HOX2a_HOX2a
--------->YAB1     --------->DOF5.7(1)     <---------CCA1(2)  <------ZmHOX2a(1) <---------RVE1(2)
---------YAB1     ---------->DOF2  --------->DOF5.7(1)  <---------ANAC58 <---------WOX13(1)      <--
--------DOF2     ---------->DOF2 ---------->DOF2 <---------AHL20(2)    --------->ATHB12         <---
---CCA1(2)---------->DOF2     <---------YAB1  <-----------------AGL3  --------->ICU4     ------>ZmHOX2a(1)
 
ctttgataatagcaaaagcccaaaggcccaaatatgaaaagctcgcttatcttttattggcgtgaggactgaactgattgatggatcatctcctctgtct  91400
                                                                              <---------MYB52(1)
                                                                             <----------DOF2
                                                                             ------>ZmHOX2a(1)
                                                                            --------->TOE2(3)
                                                                           ------>ZmHOX2a(2)
                                                                          <------ZmHOX2a(2)
                                                                         --------->RVE1(2)
                                                                         --------->ARR14(2)
                                                                         --------->ARR11(2)
                                                                         <---------ARR11(2)
                                                                         <---------GATA12
                                                                         --------->GATA12
                                                                         <---------ARR14(2)
                                                                         <---------ARR11(3)
                                                                         <---------GLK1(2)
                                                                         --------->AGP1
      ------>NtERF2                                                     --------->GLK1(1)
   <---------At4g35610                                   <------------CBF--------->ARR11(3)   <-----
   --------->At4g35610     <----------DOF2             <---------YAB1   <---------GLK1(1)    <------
--------DOF2  <---------YAB1                <---------RVE1(2)   <---------WOX13(2)  ------->TEIL
------DOF5.7(1)           <---------DOF5.7(1)        <-----------GT1 <---------At4g35610 <---------At4g35610
 
ctttgcctctgccaattttgaaagtttcttcttttgcaatcttcttagagtttgttttaccattgcaaatttagcagatcctttatgtactctgcttctt  91500
                             <---------AHL20(3)
                             <---------AHL25(2)
                             --------->AHL20(3)
                           --------->AHL25(3)
                           --------->AHL12(3)
                           <---------AHL12(3)
                           <---------AHL20(2)                                <---------AGP1
                           <---------AHL25(1)                                --------->ARR11(3)
                           --------->AHL25(1)                                <---------RVE1(2)
                   <---------ARR11(2)                                        <---------GATA12
                   --------->ARR11(2)                               --------->ANAC58      --------->GLK1(2)
                  --------->KAN1                                    --------->ANAC58   <---------YAB1
             <---------ARR11(2)          <---------ANAC46        <---------REM1(1)     <---------TOE2(3)
   --------->At4g35610    <-----------------AGL3                 --------->ALFIN1      <---------TOE1(3)
   <---------At4g35610    --------->AHL25(3)                  <---------TOE2(3)------>ZmHOX2a(2)<---
-----DOF2    --------->GLK1(2)        <---------KAN1      <----------DOF2<---------WOX13(2)<-------TEIL
---DOF5.7(1)<---------KAN1--------->AHL20(2)            <---------YAB5   <------------CBF--------->GATA12
 
tctgtctgctcaagagtttctgtattcgatataattttggaatgttgtgcaaagttttaatctttgaggtgaagcaaattgatctggtttaagattcagt  91600
                    --------->WOX13(2)
                    <---------WOX13(2)                                                        <-----
                   <---------ICU4                                                        --------->MYB52(1)
                   --------->ATHB12                                                      ------>MYB83
                  <---------AHL20(2)                                                     ------>MYB46(1)
                  --------->AHL20(2)                                                   <---------MYB59
                  <---------AHL25(1)                                                   <---------MYB111(1)
                --------->AHL12(2)                                                     --------->AtMYB61
                <---------AHL12(2)                                                     <---------MYB52(2)
               <---------AHL20(2)                                                      <---------MYB111(2)
              --------->ICU4                ------>ZmHOX2a(2)                          <---------MYB46(2)
              --------->AHL20(2)           --------->At4g35610                        --------->ANAC46
              --------->AHL25(3)           <---------At4g35610                        --------->ANAC55(2)
         <---------ANAC46                 <---------GATA12                            <---------At4g35610
       ------>NtERF2<------------CBF      <---------RVE1(2)              <---------DOF5.7(1) <------
      --------->DEAR3(1)              <----------DOF2                   <---------DOF5.7(1) --------
---------CBF------->TEIL <------------CBF --------->GATA12     <<<<<<<<<TBF1  ------>ZmHOX2a(1)
 
attgagacgacgacgtatttattaattgcattggtatttgactttgatctgaacaaaacttacttcttcttctccctcttcctctgttcacctaaccttt  91700
           --------->WOX13(2)
           <---------WOX13(2)
         <---------AHL20(2)
        --------->AHL25(1)
        <---------AHL12(3)
        --------->AHL25(3)
        <---------AHL25(2)
        <---------AHL25(1)
        <---------AHL20(3)
        --------->AHL20(3)
        --------->AHL20(2)                                        <---------At4g35610      ---------
     <---------GLK1(2)                                            <---------ZAT2        --------->LBD16
     --------->GATA12                                             --------->ZAT2       --------->ANAC46
     --------->ARR14(2)                                    <------ZmHOX2a(1)      <---------MYB52(1)
     <---------GATA12                                   --------->At4g35610    <------NtERF2
     <---------ARR11(3)                      --------->ARR11(3)   --------->At4g35610 <---------LBD16
----MYB52(1)                                 <---------ARR11(3)---------->DOF2------>NtERF2---------
----DOF2<---------AHL20(2)     <----------DOF2       --------->At4g35610     --------->DEAR3(1)
->TOE2(3)--------->AHL25(3)   <---------DOF5.7(1)    <---------At4g35610    --------->MYB46(3)  ----
 
aggctccagattttaatttctcacatttcttcgtctttgtagcaagaagatgtctaagcagaggaagaaagctgacttagccaccgttttgcgcaagtca  91800
                    --------->ANAC58
                    --------->ANAC58
                   <---------ZAT18
                   --------->SPL7(1)
  --------------->AGL15
  <---------------AGL15                   <---------TGA1a
 <-----------------AGL1              <-----------------AGL1
 ----------------->AGL3     <---------ALFIN1                     --------->At4g35610
 <-----------------AGL2--------->DEAR3(1) <---------O2    <---------At4g35610           --------->At4g35610
>ANAC58=============================================bZIP_DOF     <---------At4g35610    --------->GLK1(1)
>ANAC58---------->DOF2 <---------ALFIN1 ------>NtERF2     <---------ZAT18   ------>ZmHOX2a(1)
----------->AtSPL8--------->ALFIN1 <---------ARR14(2)     --------->At4g35610     --------->MYB52(1)
 
tggtaccacttaaggctctcggtgcgccatcccactcgggtcccgacttgggatgcgattgtgctcacagcggctagtcctgaacaagcggagctctacg  91900
                                                                      <---------At4g35610        <--
        ------>NtERF2                                               <-----------RAV1(2)       <-----
        --------->LBD16                                             <---------HSFB2a(2)    <--------
       <---------DEAR3(1)                                        --------->GATA12         <---------
      <---------LBD16                                            --------->ARR11(2)       <---------MYB46(3)
    <---------ARR14(2)                                           <---------ARR11(2)    --------->ARR14(2)
    --------->ARR14(2)                                           <---------GATA12      <---------ARR14(2)
    <---------ARR11(2)                                         ============================HOX2a_HOX2a
    --------->ARR11(2)                                         ------>ZmHOX2a(1)   <------ZmHOX2a(2)
   <---------At4g35610                                     <---------ARR14(2)     --------->ARR11(2)
   --------->At4g35610                                     <---------ARR11(2)     --------->ARR14(2)
   <------NtERF2                          <---------ALFIN1 --------->ARR11(2)     <---------GATA12
   <---------ZAT2                     --------->At4g35610  <---------MYB52(1)     --------->GATA12
   --------->ZAT2                     <---------ZAT2       --------->ARR14(2)     <---------ARR11(2)
   --------->ATERF1(1)            --------->STY1(2)      <---------MYB46(3)  --------->MYB52(1)-----
  <<<<<<<<<AtERF-3                <---------STY1(2)<----------DOF2 ------>ZmHOX2a(2)------>ZmHOX2a(2)
  <<<<<<<<<AtERF-4              <---------KAN1<-----------HVH21===========================HOX2a_HOX2a
  <---------ATERF1(1)    <----------ID1 >>>>>>>>>>>>>>>>>LFY ----------->RAV1(2)  <---------ARR14(2)
 
actggcagctccggcgagcgaaacgtatgggacgaatagctagctccactgtcactttggccgttcctgatccagatggcaaacggatcgggtctggtgc  92000
        --------->ANAC58                                       --------->LBD16
        --------->ANAC46           <---------YAB1             --------->LBD16
        --------->ANAC58         <---------ICU4            --------->PCF5
-------At4g35610                --------->ICU4        ------>ZmHOX2a(2)
----At4g35610              --------->ANAC58         --------->GATA12           ----------->HVH21   <
-At4g35610     --------->KAN1   <---------YAB1      <---------RVE1(2)  <---------ICU4              -
--RAV1(1)------->GAMYB     --------->ANAC58         --------->ARR11(3)--------->ICU4            ----
------------------>TaNAC69(2)<---------YAB5         <---------ARR11(3)<---------YAB5           <----
 
tgctactctcaacgccatttatgctctcgctcgtcattatgagaaattgggttttgatcttggtcccgaggtaaacattgtgttgacaggttagactatt  92100
                                                   --------->MYB111(1)
                                                   <---------MYB46(3)
                                                   --------->MYB111(2)
                                                   --------->MYB46(2)
                                                   --------->MYB55(2)
                                                   --------->MYB52(2)
                                                 <---------MYB52(1)
                                          --------->YAB5
                                          --------->YAB1                                       <----
                                          <--------HAHB4                                      ------
                                          --------->ATHB12                                    <-----
        <---------ZAT14                   -------->ATHB1                      --------->WOX13(2)
       <---------MYB59 <---------ANAC46   <---------ICU4          <---------WOX13(1)   --------->ARR14(2)
      --------->bZIP60(1)         --------->ARR11(3)   <------MYB83      ----------->GT1 --------->TOE1(2)
    <-----------GT1    <---------ANAC58  <---------YAB5<------MYB46(1) <----------DOF2 --------->GLK1(2)
---------ICU4          <---------ANAC58  <---------ATHB12        <---------WOX13(2)    <---------ARR14(2)
-------->ATHB51------->TEIL <---------At4g35610<---------TOE2(3)--------->YAB5<---------WOX13(2)  --
----->YAB1     --------->RVE1(2)  <---------ARR11(3)<-------GAMYB--------->WOX13(2)    ------->TEIL
-----YAB5     <---------CCA1(2)  <---------GLK1(1)<---------MYB55(1)<-----------GT1    <---------GATA12
 
cataatttgacctcactgtatctcttgcttgagttgatatctgaatcattacggtagttggttttgttgattaactttgttaatttgatgaatctgggat  92200
                                         <---------RVE1(2)
                                         <---------TOE2(3)
                                ----------->GT1
                                <---------ANAC46              --------->MYB46(3)
                                <---------ANAC58            --------->MYB52(1)
                                <---------ANAC58            ----------->RAV1(1)
                              <---------ANAC46            <---------YAB5
                              <---------ANAC58          <---------ICU4
                              <---------ANAC58          --------->YAB1              <---------ANAC46
    <-----------GT1          <---------AtMYB61         --------->ICU4               <---------ANAC58
   --------->AHL20(2)        --------->ALFIN1         --------->AHL12(2)            <---------ANAC58
-----KAN1--------->REM1(1)  <---------ZAT14           <---------AHL12(2)           <---------MYB46(3)
--->GATA12--------->GATA12  --------->ZAT14           --------->WOX13(2)   <---------ANAC46
----RVE1(2)                --------->ALFIN1           <---------WOX13(2)   <---------ANAC58
------->ZAT18    --------->AHL20(2) <---------RVE1(2)--------->YAB1        <---------ANAC58
 
gtgcaataaactacatctgtttatatagcagtgtggtgtgatttgatgttgtatgttaataatcaacagatggaagttgcgaatggtgcttgcaaatggg  92300
<- Previous    Next ->

AGI:  At1g01220.1   
Description:  GHMP kinase-related. similar to hypothetical protein OsI_009504 [Oryza sativa (indica cultivar-group)] (GB:EAY88271.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN66976.1); similar to hypothetical protein OsJ_008832 [Oryza sativa (japonica cultivar-group)] (GB:EAZ25349.1); contains InterPro domain Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); contains InterPro domain Mevalonate and galactokinase; (InterPro:IPR006206); contains InterPro domain GHMP kinase, C-terminal (InterPro:IPR013750); contains InterPro domain L-fucokinase (InterPro:IPR012887); contains InterPro domain GHMP kinase; (InterPro:IPR006204)
Range:  from: 91750    to: 95651    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version