AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                            <---------YAB1
                                                         <---------AHL12(3)
                                                         <---------AHL20(2)
                                                         <---------YAB1
                                                         <---------AHL25(1)
                                                         <---------AHL25(2)
                                                         --------->AHL25(2)
                                                        --------->AHL12(2)
                                                        <---------AHL12(2)
                                                        <---------AHL25(2)
                                                        --------->AHL20(3)
                                                        --------->AHL12(3)
                                                        <---------AHL12(3)
                                                        <---------AHL20(3)
                                                        <---------AHL25(3)
                                                        --------->AHL25(2)
                                                      <---------AHL20(2)
                                                      --------->AHL20(3)
                                                      --------->AHL20(2)
                                                      --------->AHL12(1)
        <---------RVE1(2)                             --------->AHL20(1)
        <---------ARR11(3)                            <---------AHL20(3)                        ----
    --------->REM1(2)                                 <---------AHL12(1)                     <------
 <---------ANAC46                                     <---------AHL20(1)                     -------
------>At4g35610                                      <---------AHL25(2)                   ---------
-ZmHOX2a(2)                                           --------->AHL25(2)               --------->TOE1(3)
-->RVE1(2)                                            --------->AHL25(3)         --------->TOE1(3)--
-->ARR11(3)                                        --------->AHL20(2)           --------->YAB5  <---
-->GATA12                             --------->KAN1 --------->AHL12(2)        <---------ATHB12 ====
---GATA12--------->CCA1(2)       --------->AtLEC2<---------AHL20(2)   <----------DOF2  --------->TOE2(3)
---ARR11(3)                    --------->YAB1<---------RVE1(1)     --------->ZAT6--------->TOE2(3)--
-->ARR10--------->ARR11(3)    <-------TEIL  <---------RVE1(2)<---------ZAT6<---------YAB5 --------->YAB1
 
agcatcgtgtagatatatacagaaacaaaaacattcatacaaaattcgatattttaaaatattattgttaacactttaatcaaacattaaccttaataac  67200
                   <-------MYC3
       --------->TOE1(2)
       --------->TOE2(2)
     =======================MYC_MYB
     -------->P    ------->MYC3
     ------>MYB83 --------->O2                                                            <---------ANAC55(1)
     ------>MYB46(1)                    --------->AHL20(2)                                <---------ANAC55(2)
    --------->MYB55(1)            <---------ANAC55(2)                                     <---------ANAC58
   --------->AtMYB61--------->ALFIN1    <---------AHL25(1)                                <---------ANAC46
   <---------MYB46(2)  <---------PCF2   <---------AHL20(2)                                --------->ANAC55(2)
   <---------MYB111(1) --------->TCP20  --------->AHL25(1)                                <---------ANAC58
   --------->DEAR3(1)  --------->TCP15(1) <-----------GT1                               <-----------GT1
   <---------MYB111(2)<---------TCP23 <---------WOX13(2)                           <---------ICU4
   --------->MYB46(3) <---------TCP15(2)<---------AHL25(3)                         <--------HAHB4
--->GAMYB         <---------O2    --------->ANAC55(2)                              --------->YAB1
-----GT1          ===========================================bZIP_DOF             <---------YAB5
-->MYB52(1)       <---------TGA1a --------->ANAC58                                <---------YAB1
>WOX13(2)         --------->TGA1a --------->ANAC46                                --------->ICU4
---->MYB83      <---------KAN1    --------->ANAC58    --------------->AtSPL8    <---------ICU4
------MYB59<------ZmHOX2a(1)    --------->YAB1        <---------------AtSPL8    --------->YAB1
============================MYC_MYB   --------->WOX13(2)                     --------->TOE2(3)
---->MYB46(1) <------ZmHOX2a(1)<---------ATHB12   <----------DOF2         --------->RVE1(2)        >
 
cgaacaccaacctaggaggacatgtgggtccctaatcacgaaattaaactgttctttatagtacttaaaaacaaacaaatccataatcattttacgtgat  67300
                                                                                       ----------->HVH21
                                                                                       ----------->TGA1
                                                                                      <-----------HVH21
                                                                                     <---------At4g35610
                                                                                     --------->At4g35610
                                                                               <---------GATA12
                 --------->GLK1(2)             <----------DOF2              <----------DOF2
                 ------->TEIL                  <---------DOF5.7(1)         <---------ANAC58
              <---------MYB52(2)              <---------DAG2               <---------ANAC58
             <---------TOE2(3)                <---------DOF5.7(1)      <---------At4g35610<---------DEAR3(1)
            <-----------GT1                 --------->ARR11(3)    <---------YAB1     --------->LBD16
            --------->MYB52(1)              <---------ARR11(3)<---------ARR14(2)   <---------LBD16
          <---------MYB52(2)          <---------ANAC55(2)     <---------RVE1(2)--------->GATA12
         --------->WOX13(2)           --------->ANAC58        --------->ARR14(2) ------>ZmHOX2a(2)
         <---------WOX13(2)           <---------ANAC46        --------->ARR11(3)<---------GLK1(1)
     --------->YAB1                   --------->ANAC58       <------ZmHOX2a(1) <---------ARR11(3)
   ------>MYB83------->GAMYB         <---------LBD16         ===========================HOX2a_HOX2a
   ------>MYB46(1)                 ----------->TGA1     --------->WRKY18(1)<---------ANAC46
>>>>>>>>>MYB80--------->MYB46(3)   ----------->HVH21   <-----------HVH21<---------RAP2.6(2)
 
caaaccaaacacaattaacgaacctgttcgaccattttgtgacggaagaccttttctcggtcgaggattttgatagcggcttgatctccggtgacggtgt  67400
                                                                                       <---------DOF5.7(1)
                                                                                      <------NtERF2
                                                                                     ------>NtERF2
                                                                                    --------->DEAR3(1)
                                                                                   <------NtERF2
                                                                                   --------->ATERF1(1)
                                                                                  <-----------HVH21
                                                                                  ------>NtERF2
                                                                                 <---------O2
                                                                                 --------->DEAR3(1)
                                                                                 --------->O2
                                                                                 <---------DEAR3(1)
                                                                                --------->ATERF1(1)
                                                                                <------NtERF2
                                                                                --------->RAP2.3(1)
                                                                               <---------RAP2.3(1)
                                                                               ------>NtERF2
                     --------->ZAT2                                            --------->LBD16
                     <---------HSFB2a(1)                                       <---------ATERF1(1)
                     <---------At4g35610                                      <---------DEAR3(1)
            --------->TOE2(3)                                                 --------->ATERF1(2)
            --------->TOE1(3)                                                 --------->DEAR3(1)
            <---------DAG2                                                    <---------ATERF1(2)
         <-----------GT1                             --------->KAN1          --------->ATERF1(1)
     <-----------ARR10           --------->LBD16  <---------ANAC55(2)        <---------LBD16
    <---------KAN1   <---------HSFC1(2)           ----------->GT1           <---------ATERF1(1)
  <---------ANAC58   --------->HSFC1(2)           --------->ANAC55(2)      --------->ANAC46     ----
  <---------ANAC58   --------->HSFB2a(1)  ---------->ID1               ------>ZmHOX2a(1)        <---
  <---------ANAC46   --------->At4g35610<---------ANAC58          <---------ANAC58<---------ATERF1(1)
 ---------->ID1     <-----------ARR10   <---------ANAC58          <---------ANAC58<---------RAP2.3(1)
 
tcttggcgtatttcaccttagcgaagcttccttctccgagagttcgtcccatctcgtaattccctactcgcgtcctactcgccggcgtcgccttccttct  67500
                                                         --------->WOX13(1)
                                                       <---------KAN1
                                                      --------->ARR14(2)
                                                      --------->GLK1(2)
                                                      --------->ARR11(2)
                                                      --------->RVE1(2)
                                                      <---------GATA12
                                                      --------->GATA12
                                                      ------->TEIL
                                                      <---------ARR11(1)
                                                      <---------ARR11(2)
                                                      <---------ARR14(2)
                                                  <------NtERF2
                                                  --------->RAP2.3(1)
                                                  <---------------------WRI1
                                                 <---------ORA47(2)
                                                 <---------DEAR4(2)
                                                 <---------ATERF1(1)
                                                 ------>NtERF2
                                                 <---------RAP2.3(1)
                                                 <---------ERF1
                                                <---------DEAR3(1)
                                                --------->ATERF1(2)
                                                <---------ATERF1(2)
                                                <---------RAP2.3(2)
                                                --------->DEAR3(1)
                                                <---------RAP2.3(3)
                                               <---------LBD16
                                               --------->ATERF1(1)
                                             ------>ZmHOX2a(2)
                                             <---------DEAR3(1)
                                           --------->ARR14(2)
                                           <---------RVE1(2)
                                           --------->GATA12
                                           <---------ARR14(2)
             <---------DOF5.7(1)           --------->ARR11(2)
            <----------DOF2       --------->MYB46(3) <---------ARR14(1)                    ------>ZmHOX2a(1)
     <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)  <---------ARR11(2)                      --------->ARR11(3)
    <---------ATHB12            --------->MYB52(1)--------->ATERF1(1)              <---------ARR11(3)
----->At4g35610              --------->RVE1(2) <---------ABI4(1)                   <-----------ARR10
------At4g35610         <---------TOE2(3)  <---------GATA12      <---------YAB1    --------->RVE1(2)
 
gcttccactcattttctttttccgattaagaaaatcaacggctctagatcggcggcgaatctatcaatgtgattcttctccctcaatatctctccttctt  67600
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                              ------
                                                                                              ------
                                                                                             -------
                                                                                      --------->TCP15(1)
                                                                                      --------->TCP20
                        *TSS  --------->DAG2                                         <---------TCP15(2)
                       <---------TGA1a                                           <-----------RAV1(1)
                       <---------O2                                            <---------ARR14(2)  -
                       =================bZIP_DOF           ----------->HVH21   <------------CBF    -
                <---------TOE1(3) --------->ZAT18          <------NtERF2--------->ANAC58   ---------
                <---------TOE2(3)--------->ALFIN1         ------>NtERF2 --------->TGA1a   <---------ANAC55(2)
            <----------DOF2  ---------->DOF2        --------->WOX13(2)  <---------TGA1a--------->PCF2
            =====================bZIP_DOF         <---------AHL20(2)    --------->ANAC58  <---------ANAC46
      <---------ANAC46 --------->TGA1a           --------->AHL20(2)   --------->KAN1<---------MYB46(3)
     ------>NtERF2  ----------->TGA1             --------->AHL25(3)  ----------->HVH21<---------PCF2
  --------->At4g35610 <-----------------------TaNAC69(2) --------->ANAC46  --------->LBD16--------->ANAC55(2)
 <---------MYB46(3) ----------->HVH21          <---------GATA12     <-----------HVH21<---------TCP23
 
ctagtggctgcctggttttaaggctgacgagagaaagtggacgagcgagagatttaataggcgcgactgggagtcacgcgcgtattgtgggtcccgtatg  67700
                                                                                                  --
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                            --------->LBD16                                      <--
                                           <---------ANAC58                                      ---
                                   <-----------HVH21                                             <--
              --------->YAB5       <-----------TGA1                                              <--
    ----------->GT1               --------->bZIP60(2)                                            ---
-------->ANAC58  <---------ICU4   --------->ANAC46                                               <--
-------->ANAC55(1)<---------AHL20(3)       <---------ANAC55(2)                                  ----
-------->bZIP60(2)--------->AHL25(2)       <---------ANAC46                                     <---
-------->O2   <---------ICU4     --------->LBD16                                                <---
-------->ANAC46 <---------YAB1  <---------ANAC46                                                ----
---------ANAC55(2)--------->AHL20(3)       --------->ANAC55(2)                                  <---
--->ANAC58    --------->YAB1    <---------ANAC58                          --------->TOE2(3)     ----
--->ANAC58   --------->ICU4     <---------ANAC58                   <-------TEIL                 <---
-->SPL7(1)   <---------ATHB12<---------ARR11(2)                 --------->KAN1                  <---
-------->ANAC55(2)<---------AHL25(2)       <---------ANAC58    ------->TEIL        <---------YAB5---
-------->ANAC58 --------->ICU4 <---------LBD16              <---------ANAC58 --------->KAN1     ----
>LBD16     --------->YAB1    --------->ARR11(2)             <---------ANAC58<-------TEIL--------->YAB1
 
ccacgtaatgtcaaaaatcattattttgctctgttccgcgtcagtcccgtgttatttgtacttgtgtacgttcgtaacgttcattcttcattcatataaa  67800
       <---------AHL20(3)
       --------->AHL20(3)
      <---------ICU4
      --------->ATHB51
   --------->TOE2(3)
------->KAN1
--------AHL12(1)
-------AHL12(1)
------>AHL12(3)
-------AHL12(2)
------>AHL12(1)                                                                                    -
-------AHL25(3)                                                                                 ----
-------AHL25(2)                                                       <---------AHL25(2)       <----
------>AHL25(1)                                                       <---------AHL20(3)       -----
-------AHL25(1)                                                       --------->AHL12(1)       -----
----->AHL20(2)                                                        <---------AHL12(2)       <----
------AHL20(2)              --------------->AGL15                     --------->AHL25(2)       <----
------AHL20(3)              <---------------AGL15                    <---------AHL12(1)   <---------ANAC46
----->AHL20(3)             ----------------->AGL2                    --------->AHL12(1)<---------AHL20(2)
------AHL12(3)             <-----------------AGL3                 --------->YAB1       <---------AHL25(3)
----->AHL12(3)             ----------------->AGL3    <---------ARR14(2)                --------->AHL25(3)
------AHL25(1)        ----------->GT1       ------>ZmHOX2a(1)    <---------YAB1       <---------AHL20(3)
------AHL25(2)     <---------ANAC58   --------->KAN1 --------->ARR14(2)              --------->AHL12(2)
------>AHL25(2)    <---------ANAC58  <---------GLK1(2)        <---------AHL20(2)     --------->WOX13(2)
----->AHL25(3)     <---------ANAC46  --------->ARR11(2)    <---------RVE1(2)       <---------AHL20(2)
 
aaaattccataattttgttcttgtgtggtaactatatacagaaactcctgtttaagtatatggattttatgaaaattttggggttttaaatttatgtgga  67900
                                               <---------ARR14(2)
                                               --------->ARR11(2)
   --------->AHL25(3)                          <---------ARR11(2)      --------->KAN1
---------->GT1                            <---------ANAC46            <-------TEIL
----->CCA1(2)                        <---------ICU4                   <---------YAB5
-----ARR11(2)                        --------->YAB5         <----------DOF2
---->ARR11(2)                       <---------YAB5       --------->ARR11(3)
---->ARR14(2)                  --------->TOE2(3)         <---------ARR11(3)
-----RVE1(2)         <---------RVE1(2)<----------DOF2   <---------CCA1(2)                        ---
-----ARR14(2)    ----------->GT1------>ZmHOX2a(1)  --------->YAB5  --------->YAB5                ---
 
tatggttttatttgtaagggatgtgatttgatgtccttaatctttatgtgtatatgagtatatctttcagtgattcattccattctactgatgttcaaag  68000
           <---------AHL20(2)
           <---------AHL25(2)
           --------->AHL25(2)
           --------->AHL25(1)                                  <---------DAG2
           --------->AHL25(3)                                  <----------DOF2
           --------->AHL12(3)                             <---------AHL25(2)                       <
       --------->YAB1                                     --------->AHL25(2)                       -
      <---------YAB5                                     --------->YAB1                       ------
      <---------YAB1                          --------->AHL12(1)                         <----------
  <-------GAMYB                               <---------AHL12(1)                <---------WOX13(2) -
------>WRKY38(1)                <----------DOF2<---------GLK1(2)                --------->WOX13(2) -
------>WRKY12     <---------RVE1(2)           --------->KAN1<-----------GT1 <----------DOF2   <-----
 
ttgactgttatcatattatttgatatagttgtattcttttcatgtagaaatattctctaaatataacttttttttttgtctttagttagaagttggaaac  68100
<- Previous    Next ->

AGI:  At1g01140.1   
Description:  CIPK9 (CBL-INTERACTING PROTEIN KINASE 9); kinase. similar to CIPK23 (CBL-INTERACTING PROTEIN KINASE 23), kinase [Arabidopsis thaliana] (TAIR:AT1G30270.2); similar to CIPK23 (CBL-INTERACTING PROTEIN KINASE 23), kinase [Arabidopsis thaliana] (TAIR:AT1G30270.1); similar to CBL-interacting protein kinase 12 [Populus trichocarpa] (GB:ABJ91219.1); contains InterPro domain NAF; (InterPro:IPR004041); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threon
Range:  from: 64166    to: 67625    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version