AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                   <---------WOX13(2)
                                                                                   --------->WOX13(2)
                                                                                   <---------AHL12(2)
                                                                                  --------->YAB1
                                                                  <---------ANAC46<---------ICU4
                                                                  --------------->AGL15
                                                                 <---------LBD16  --------->ATHB51
                                                               <---------ARR11(2) --------->YAB5
                                                               --------->ARR11(2)--------->ICU4
                                                            --------->ANAC58     <---------AHL12(1)
                                   --------->TOE2(3)        --------->ANAC58     --------->AHL20(2)
            ---------->DOF2        --------->TOE1(3)      <---------ALFIN1       --------->AHL25(3)
     <--------P                   <---------KAN1         <---------ZAT2        --------->YAB1
----------->RAV1(2)              <---------TOE1(2)    --------->MYB46(3) <---------TOE2(3)
------->DEAR3(1)            <---------ARR11(2)  --------->At4g35610    ---------->DOF2
----->GAMYB--------->AtMYB61------->TEIL        <---------At4g35610--------->LBD16<--------HAHB4
------>MYB46(3)             --------->ARR11(2) --------->MYB52(2)----------------->AGL3
------>DEAR3(2)             --------->RVE1(2)<---------MYB52(1)--------->ARR14(2)--------->AHL12(1)
---->ARR11(2)            <---------KAN1     <-----------HVH21  <---------ARR14(2)<---------KAN1
-----ARR11(2)      --------------------->WRI1<--------P  --------->ZAT2=============================
 
accgcctggttagaccaaagctcagagaacgtatcgaacgttagaccggttagctgaaccagcacggttccggttaaaggaagaataattaagaagaaga  58800
                                                                  <---------GATA12
                                                                 --------->KAN1
                                                                <---------ICU4
                                                                --------->AHL12(1)
                                                                <---------AHL25(3)
                                                 <----------DOF2<---------AHL25(1)
                                               <---------At4g35610--------->ARR14(2)
                                               --------->At4g35610<---------ARR14(2)
                                         <---------ARR14(2)     <---------AHL12(1)
                                         --------->ARR14(2)     <---------AHL20(2)
        --------->O2                     ------->TEIL--------->MYB46(3)
        <---------TGA1a               --------->ANAC58        <---------WOX13(2)
        <---------bZIP60(2)           --------->ANAC58  ------->TEIL                            ----
        --------->TGA1a               --------->ANAC46------->GAMYB <---------LBD16            -----
        <---------O2                  --------->ANAC55(1)     --------->AHL12(2)              ------
    <-----------HVH21                 --------->ANAC55(2)     --------->WOX13(2)             -------
   <---------MYB46(3)  --------->ZAT14<---------ANAC55(2)----------->GT1                     <------
==================bZIP_DOF        <-----------HVH21--------->MYB52(1) --------->LBD16    <---------YAB1
 
gaatggtggtcacgttgcaagagttgtgaagtccaagcttcacgtatttgagcttaacggacgttaataaatccggcaaacgtcttcgaattcttataac  58900
                               <---------MYB52(1)                                               <---
                              --------->At5g28300                                               <---
     <---------YAB1        --------->LBD16                                                      ----
   --------->YAB1          ------>NtERF2                                                        ----
   --------->YAB5         --------->DEAR3(1)                                                   -----
  <---------ATHB12        --------->ANAC46                                                     -----
  --------->ICU4 --------->ANAC58                                                              <----
<---------At4g35610      <---------LBD16          --------->RVE1(2)                            <----
--->GAMYB        --------->ANAC46            <------ZmHOX2a(2)                                 <----
---->MYB46(3)    --------->ANAC58           --------->GATA12                  <---------ZAT14  -----
--->RAP2.6(3) --------->ARR11(2)            <---------GATA12<---------MYB52(1)--------->ZAT14 ------
-->MYB52(1)<---------HSFB2a(2)<-------GAMYB <---------ARR11(2)           <xxxxxxxxxxxxxxxsmallRNA(si3)
-----GT1------->TEIL   --------->ARR14(2)   --------->ARR11(2)<---------MYB46(3)          ----------
 
ggccgatgatgaatctcgaaacgccatctccgccgttaatctctctcgatccatctcaatgctgtttgttctctccatcagtatagttttgggtcgaaat  59000
        --------->WOX13(1)
    ----------->GT1
    --------->ANAC58
    --------->ANAC58
------AHL25(3)
------AHL12(1)
----->AHL25(2)
----->AHL12(1)
---->AHL12(1)
---->AHL12(3)                                      <---------GATA12
-----AHL12(1)                             <----------DOF2                                     <-----
-----AHL12(3)      <------ZmHOX2a(1)     --------->YAB5                                      <------
-----AHL25(1)--------->ANAC58          <---------ARR11(3)          --------->DOF5.7(1)       <------
---->AHL25(1)--------->ANAC58          --------->ARR11(3)        ---------->DOF2          --------->GLK1(1)
--->AHL25(3) <---------TOE2(3)   ----------->GT1   <---------ARR14(2)           --------->YAB1------
->GT1--------->TOE2(3)       --------->AHL20(2)    --------->ARR14(2)  ----------->GT1    <---------GLK1(1)
 
atttcaaacgtaaatcaaggaaggattgaagataaaatgtaaaatctttaggcaaatttggagaaatagaaagagagagaaaatgagaatgggaattcta  59100
                                                                                          --------->YAB1
                                                                               <---------AHL12(2)
                                                                              --------->AHL25(2)
                                                                              <---------AHL25(3)
                                                                              --------->AHL20(3)
                                                                              <---------AHL20(3)
                                                                              --------->AHL12(1)
                                                                              <---------AHL12(1)
                                                                              <---------AHL25(2)
                                                                              --------->AHL20(1)
                                                                              --------->AHL20(2)
                                                                              <---------AHL20(1)
                                                                             --------->AHL25(1)
                                                                             <---------AHL12(3)
                                                                             <---------AHL25(1)
                                                                             --------->AHL25(3)
                                                                             <---------AHL25(3)
                                                                             --------->AHL12(3)
                                                                             <---------AHL12(1)
                                                                             --------->AHL12(1)
                                                                            <---------AHL20(1)
                                                                            --------->AHL12(1)
                                                                            --------->AHL25(2)
                                                                            <---------AHL12(2)
                                                                            --------->AHL20(1)
                                                                            <---------AHL25(2)
                                                                            <---------AHL12(1)
                                                                            --------->AHL12(2)
                                                                            <---------ARR11(3)
                                                                            --------->AHL25(3)
                                                                           --------->AHL12(3)
                                                                           <---------AHL25(2)
                                                                           <---------AHL12(3)
                                                                           --------->AHL12(2)
                                                                         --------->AHL25(1)
                                                                         <---------AHL20(3)  -------
              <------ZmHOX2a(1)                                          --------->AHL20(3)  -------
           <------ZmHOX2a(1)                                      ---------->DOF2         --------->AHL12(2)
      --------->WOX13(2)                                          *TSS   --------->AHL20(2) <-------
      <---------WOX13(2)                                        --------->ANAC58      --------->YAB5
 ----------->GT1    ----------->GT1                             --------->ANAC58 <---------AHL20(2)
----------AGL15<---------ARR14(2)                            --------->ZAT18--------->ARR11(3)  ----
-----------AGL3--------->ARR14(2)                  --------->CCA1(2)     <---------AHL12(3)<--------
-----------AGL2--------->ARR11(3)                 --------->ARR11(3) ----------->GT1 <---------YAB5
--------->AGL15<---------RVE1(2)                  <---------ARR11(3)----------->GT1  --------->ICU4<
 
aaattggtgaattaggaggattttggtgaaatgagggcaagtagggatggagagatatatagagtgcaagaaagataaaaatattttaaagattaataat  59200
                                                         <---------ARR11(2)
                                                         --------->ARR14(2)
                                                         --------->ARR11(2)
                                                -------->HAHB4
                                                --------->ATHB12
                                                <---------ICU4
                                               <---------YAB1
                                               <---------YAB5
                                               --------->ICU4
                                            <---------AHL25(3)
                                            <---------AHL20(2)
                                           <---------AHL25(1)
                                           --------->AHL25(3)
                                           <---------AHL20(3)
                                           --------->AHL20(3)
                                           <---------AHL20(2)
                                           --------->AHL20(2)
                                           --------->AHL25(1)
                                  --------->KAN1--------->YAB1
                                 --------->AHL20(3)    <---------MYB46(3)
                                 <---------AHL12(2)    <------MYB83
                                 <---------AHL25(2)    <------MYB46(1)
                                 <---------AHL20(3)    --------->MYB55(2)
                                 --------->AHL12(2)   <---------DEAR3(1)
                                 --------->AHL25(2)   <---------AtMYB61
                                --------->AHL25(1)    --------->ALFIN1
                                <---------AHL12(3)  <---------ANAC58
 --------->ICU4                 <---------AHL25(2)  <---------ANAC58
 <---------YAB5                 --------->AHL20(2) --------->MYB55(2)
-->YAB1                         --------->AHL12(2) <---------MYB46(3)
->HAHB4                         --------->YAB1 <---------ATHB12       <---------YAB1
--YAB1                         <---------KAN1 <---------TOE2(3)     --------->ZAT6
----->YAB1                 ----------->GT1 <---------AHL25(2)   <---------ARR11(3)
-AHL12(2)              --------->DOF5.7(1) --------->AHL25(2)--------->LBD16                  <-----
---------ICU4        ---------->DOF2      <---------KAN1 <---------ARR14(2) --------->At4g35610
 
agtaatgacttaacaaaaaaaaaaaaaagatggaataatattcgaatttaatgatgggtggttccgagataatactattagctcaactacttatatggga  59300
                     <---------GLK1(2)
                 <---------YAB5
          --------->AHL20(2)
        --------->WOX13(2)
      <---------AHL20(2)
      --------->AHL20(2)
      --------->AHL20(1) --------->AHL12(2)
      <---------AHL20(1) <---------YAB1
      --------->AHL20(3) <---------AHL12(2)
      <---------AHL20(3)--------->AHL25(2)
      <---------AHL25(2)--------->AHL12(2)                                          <---------GATA12
      <---------AHL25(1)<---------AHL12(2)                                          ------->TEIL
      --------->AHL25(1)<---------AHL25(2)                                          --------->GATA12
      <---------AHL25(3)<---------AHL20(3)            --------->ANAC58             <---------GLK1(2)
      --------->AHL25(2)--------->AHL20(3)            --------->ANAC58         --------->At4g35610
     --------->AHL20(2)--------->AHL12(1)    --------->ANAC46                  <---------ZAT2
     --------->AHL25(3)--------->AHL25(3)    --------->ANAC58                  --------->ZAT2
    --------->AHL12(2) <---------AHL12(1)    --------->ANAC55(1)               <---------At4g35610
 <---------RVE1(2)  <---------At4g35610 <---------ZAT18                       ------>MYB46(1)
----PCF2<---------WOX13(2)  <-----------GT1  --------->ANAC58---------->DOF2  ------>MYB83
 
ccttgatattaaattaagtagtcagattatttttcatgttttgttcacacgaaatgcaagttacaaaagtctaacaaaacctagctgaatctcataagtc  59400
                                                                                 <---------AHL25(3)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL25(2)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL12(3)
                                                                                 --------->AHL25(1)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL12(3)
                                                                                <---------AHL25(3)
                                                                                --------->AHL25(2)
                                                                                <---------AHL25(2)
                                                                                --------->AHL25(3)
                                                                                <---------AHL25(1)
                                                                                --------->AHL25(1)
                                                                                <---------AHL20(1)
                                                                                --------->AHL20(2)
                                                                                <---------AHL20(2)
                                                                                --------->AHL12(3)
          --------->AHL25(3)                                                    --------->AHL12(1)
          --------->AHL20(2)                                                    <---------AHL12(1)
       --------->YAB5                                                        ------>MYB83
       --------->YAB1                              --------->YAB1            ------>MYB46(1)
      <------ZmHOX2a(2)                           <---------YAB5           <---------MYB59
     --------->ARR11(3)                 --------->KAN1  --------->KAN1     --------->TOE2(3)
     <---------GATA12<-----------GT1    <---------AHL20(2)              <---------ARR11(2)
     <---------ARR11(3) <----------DOF2--------->AHL25(3)               <-----------GT1
  <--------P    <------MYB83           <---------AHL25(2)            <---------REM1(1)
----------->GT1 <------MYB46(1)        --------->AHL25(2)          <---------ANAC46
 
atatggtagatcataaatttggtttatcttttttttcacacatatatttgggcatcataacattctattttggtgtaacctaattttttttttttttgaa  59500
                                                                                <---------AHL25(1)
                                                                                <---------AHL20(2)
                                                                                --------->AHL20(2)
                                                                                --------->AHL25(1)
                                                                              <---------WOX13(2)
                                                                              --------->WOX13(2)
                                                                             --------->YAB5
                                                                            <---------YAB1
                                                                         ------>ZmHOX2a(1)
                                    ----------->RAV1(1)                 --------->TOE2(3)
                           <-----------GT1                        <---------AHL20(2)
                         <---------ICU4                           <---------AHL12(3)
                         --------->YAB1                           --------->AHL12(3)
                        <---------YAB5                            <---------AHL25(1)
                       --------->WOX13(2)                        --------->AHL25(3)
                       --------->AHL12(2)                        <---------AHL20(1)
                       <---------AHL12(2)                        --------->AHL20(1)      <---------YAB5
                       <---------WOX13(2)----------->RAV1(1)    --------->AHL12(2)       <---------TOE2(3)
         ----------->RAV1(1)  --------->ZAT6      ----------->HVH21  <-----------GT1--------->TOE2(3)
 <---------YAB1   ----------->GT1  --------->REM1(1)       <---------MYB46(3)--------->YAB1       <-
 
gtttttgataaacaacataacttgttaattataccactacaacacaacaaaatatgacatgtttgttatatatttccttataattaaacttaaacgtttt  59600
                                                                               --------->AHL20(2)
                                                                      <---------AHL12(2)
                                                                     <---------AHL25(3)
                                                                    <---------AHL12(1)
                                                                    <---------AHL20(2)
                                                                    --------->AHL12(3)
                                                                    <---------AHL12(3)
                                                                    --------->AHL20(2)
                                                                    <---------AHL25(1)
                                                                    --------->AHL25(1)
                                                                    --------->AHL12(1)
                                                                    <---------AHL25(3)             <
                                                                  --------->AHL20(3)              <-
                                                                  <---------AHL25(2)              <-
                                                                  <---------AHL20(3)   --------->AHL20(3)
                                                                  --------->AHL25(2)   <---------AHL20(3)
                                                                 --------->AHL12(2)   --------->YAB1
                                                                 <---------AHL12(2)  <---------YAB1-
                                                         ----------->GT1     <---------WOX13(2)   <-
                                                         --------->ANAC58    --------->WOX13(2)   --
                                                         --------->ANAC58--------->RVE1(2)      <---
                                               <---------ANAC58 <---------AHL20(2)  --------->AHL20(3)
                                <------MYB83   <---------ANAC46 --------->AHL20(2)  --------->AHL25(2)
                                <------MYB46(1)<---------ANAC58 <---------AHL20(3)  --------->AHL20(2)
  <-------TEIL --------->WOX13(2)          --------->WOX13(2)   --------->AHL20(3)  <---------AHL20(3)
--------YAB5 <---------YAB1------->TEIL    <---------WOX13(2)  --------->AHL20(2)   <---------AHL25(2)
 
agacatccatgatgtttttattagcaagtgtatgtaggttatccaaaattgagtgagggcaagttataaaattatatatcaattgaatattataagcagg  59700
<- Previous    Next ->

AGI:  At1g01120.1   
Description:  KCS1 (3-KETOACYL-COA SYNTHASE 1); acyltransferase. Identical to 3-ketoacyl-CoA synthase 1 (KCS1) [Arabidopsis Thaliana] (GB:Q9MAM3;GB:Q56YX9;GB:Q9ZTK3); similar to beta-ketoacyl-CoA synthase, putative [Arabidopsis thaliana] (TAIR:AT2G26640.1); similar to fatty acid elongase 3-ketoacyl-CoA synthase [Brassica napus] (GB:AAT65207.1); similar to 3-ketoacyl-CoA synthase 10 [Gossypium hirsutum] (GB:ABX10440.1); similar to fatty acid elongase 3-ketoacyl-CoA synthase [Brassica napus] (GB:AAT65206.1); contains InterPro domain Very-long-chain 3-ketoacyl-CoA synthase (InterPro:IPR012392); contains InterPro domain Thiolase-like; (InterPro:IPR016039); co
Range:  from: 57269    to: 59167    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version