AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         <---------ARR14(2)
         <---------ARR11(1)
      --------->YAB1
----->P  --------->RVE1(2)
---->TEIL--------->ARR11(3)
->ZmHOX2a(2)
--->CCA1(2)
-ZmHOX2a(2)
-->RVE1(2)
-->ARR14(2)
---ARR14(2)
---GATA12<---------ARR11(3)                                                    <---------GATA12
-->GATA12--------->ARR14(2)                                              <----------ID1
-->AGP1 <---------CCA1(2)           <----------DOF2                 --------->YAB5
-->ARR11(3)                        <---------DOF5.7(1)              <---------ICU4
---ARR11(3)                       ------>ZmHOX2a(1)                <---------ATHB12            -----
-----ARR10                    ------>ZmHOX2a(1)              <---------ANAC55(2)          ----------
>DOF5.7(1)                 <---------ATHB12                --------->AHL20(2)  --------->RVE1(2)
 
tacctagtatcatatcttcatacaactccaatccttcctctttggttatcaactatttcaaattacttaaatcaatacaacaaatctcacaacttgtaaa  48900
                                                                                                   -
                                     <------MYB46(1)                                               <
                                     ----------->GT1                                             <--
                               <-----------RAV1(2)                                            <-----
                             --------->SPL7(1)                                               <------
                           --------->ZAT18--------->ATHB51                                   <------
    --------->DOF5.7(1)    <---------SPL7(1)           <---------ANAC58                      -------
  ---------->DOF2<------ZmHOX2a(1)   <------MYB83   <---------WOX13(1)                       -------
<---------HSFB2a(2)       <---------ANAC58-------->ATHB1                                     -------
<---------------AGL15    --------------->AtSPL3    <---------ANAC58       --------->LBD16    <------
--------------->AGL15 <------ZmHOX2a(1)  <---------YAB1<---------ANAC58   ------>ZmHOX2a(1) --------
---->KAN1   <-----------------------TaNAC69(2)     <---------ANAC58       ==========================
->GT1    <------ZmHOX2a(1)<---------ANAC58--------->ATHB12     ----------->HVH21    ----------->HVH21
 
attccaaaagaaggagacgaggagaggaagcgtaccaggctggtattattggtggattgcttctccttgacaacttcctggacagagacgacgggagatc  49000
                                                                                 <---------LBD16
                                                       ---------->DOF2           ------>ZmHOX2a(2)
                                                      =================================HOX2a_HOX2a
                                                      <------ZmHOX2a(1)         <------ZmHOX2a(2)
                                                      ==================================HOX2a_HOX2a
                                                   <---------LBD16             <---------GATA12
                                                   --------->LBD16             --------->GATA12
      <-------GAMYB                               <---------TOE1(1)            <---------ARR11(2)
     <---------ANAC58                             <---------TOE2(1)            <---------RVE1(2)
     <---------ANAC58                            ==========================HOX2a_HOX2a
     <---------ANAC46                            =======================HOX2a_HOX2a
    <------NtERF2                                ------>ZmHOX2a(2)             --------->ARR11(2)
  <---------DEAR3(1)                            ========================HOX2a_HOX2a
  --------->ALFIN1                              ===========================HOX2a_HOX2a
--------->ALFIN1                                =============HOX2a_HOX2a       --------->ARR14(2)
-------->MYB55(2)                               <------ZmHOX2a(2)         <---------ARR11(2)
---------MYB46(3)                              --------->ARR14(2)         --------->MYB52(1)    <---
-------LBD16                                   --------->ARR11(2)   <------ZmHOX2a(1)           ----
-ZmHOX2a(2)                                    <---------ARR11(2)   ====================HOX2a_HOX2a
---ARR11(2)                                    <---------GATA12     --------->ATERF1(1)         <---
---GATA12                                      --------->GATA12     ===================HOX2a_HOX2a
-->ARR11(2)                                    <---------ARR14(2) --------->ALFIN1             -----
-->GATA12                                      <---------RVE1(2) ======================HOX2a_HOX2a
-->ARR14(2)                                  ----------->ARR10   =======================HOX2a_HOX2a
---ARR14(2)     <---------WOX13(1)           <---------MYB46(3)  <------ZmHOX2a(1)            ------
->GLK1(1)     --------->ATHB12              --------->ALFIN1    --------->DOF5.7(1)         --------
=HOX2a_HOX2a <---------YAB5           --------->MYB52(1) --------->DOF5.7(1)   <---------ARR14(2)
 
gacgggtggcgttggagtgattgagtctgcgaagggagagggaacgggtggatccgaggaaagaagaaggaggagccaatcggatcgggagcaagagacg  49100
                    <---------ARR11(2)
         =================HOX2a_HOX2a
        <------ZmHOX2a(2)
        ==================HOX2a_HOX2a
       --------->ARR11(2)                                          <---------YAB1
       <---------ARR14(2)                                        --------------->AGL15
       --------->GATA12                                          <---------------AGL15
       <---------GATA12                                   <------NtERF2                         ----
       <---------ARR11(2)                               --------->DEAR3(1)                      ----
       --------->ARR14(2)         --------->At4g35610   <---------ETT(2)                        <---
<---------YAB1      --------->ARR14(2)                 --------->ATERF1(1)                      <---
------ARR14(2)      <---------ARR14(2)                 <------NtERF2                --------->YAB1
----->ARR14(2)      --------->ARR11(2)       --------->At4g35610<-----------------AGL2    --------->MYB52(1)
------GLK1(2)      <------ZmHOX2a(1)       <---------PCF2------>NtERF2             <---------ATHB12
---->YAB5------>ZmHOX2a(2)        <---------ZAT2      <---------ATERF1(1)  <---------GLK1(1) -------
----->ARR10 --------->AtLEC2      <---------At4g35610--------->DEAR3(1)   --------->ARR11(2)--------
->CCA1(2)<-------TEIL           <---------ZAT18 ---------->DOF2 <-----------------AGL3    <---------
 
attctcatgggatccatgcagaggaaccgtggcagtgagcttagtgggagcgaaagccgtcgccattgctatcaatggaaaccccaatgagattaacgga  49200
                                                                                              ------
                                                                                              ------
                                                                                             -------
                                                                                            <-------
                                                                                          <------ZmHOX2a(2)
                                                                                         --------->ARR14(2)
                                                                                         --------->ARR11(2)
                                                                                         <---------ARR14(2)
                                                     <------NtERF2                       <---------GATA12
                                                   <---------DEAR3(1)                *TSS--------->GATA12
----------->GT1                         <---------ZAT14                              <---------At4g35610
----->ARR14(2)                   ---------->DOF2  <---------------------WRI1       <-----------RAV1(2)
----->GLK1(1)           --------->LBD16 --------->At4g35610                    <------ZmHOX2a(1)
------GLK1(1)          <---------HSFB2a(2)     --------->ALFIN1                ==================HOX2a_HOX2a
------ARR14(2)         --------->HSFB2a(2)   --------->CCA1(2)              <------NtERF2<---------ARR11(2)
>GAMYB                <---------LBD16   <---------At4g35610                 <---------At4g35610
->ANAC46           <----------DOF2 --------->DOF5.7(1)                      --------->At4g35610
--GT1        <---------AHL12(2) --------->AHL20(2)<---------LBD16--------->CCA1(2)<------NtERF2
 
attcggaaaaaaaaaaaaaaaactttctgggaaaataaaagagagcagagatgggcggagagaacaagagatgagaggcagaggaggcagacgatcccgg  49300
                                             <---------ATHB12
                                          <---------AHL25(3)
                                          <---------AHL25(1)
                                          --------->AHL20(2)
                           --------->KAN1 --------->AHL25(1)
                   <---------AHL20(2)     <---------AHL20(2)
                  <---------YAB1         --------->AHL20(2)
                  --------->AHL25(3)    --------->AHL12(2)
                 <---------AHL12(3)     <---------AHL12(2)
                 <---------AHL20(2)    <---------AHL25(3)
                 <---------AHL20(3)   --------->AHL25(1)
                 <---------AHL25(2)   --------->AHL12(1)
                 --------->AHL20(3)   <---------AHL12(3)
                 --------->AHL12(3)   --------->AHL12(3)
               --------->AHL20(3)     <---------AHL12(1)
               <---------AHL20(2)     --------->AHL20(2)
               <---------AHL12(3)     <---------AHL25(1)
               --------->AHL12(3)     <---------AHL25(3)
               <---------AHL20(3)    --------->AHL25(3)
              --------->AHL12(2)     --------->AHL12(2)
              <---------AHL12(2)     <---------AHL12(2)
             <---------AHL12(1)      --------->ARR11(3)
             <---------AHL25(1)      <---------ARR11(3)         <---------DOF5.7(1)
             <---------AHL12(3)      --------->AHL12(1)       <---------DOF5.7(1)
             --------->AHL12(3)      <---------AHL12(1)      <---------DOF5.7(1)
             --------->AHL12(1)      <---------AHL25(2)     <---------ALFIN1
             <---------AHL20(2)      <---------AHL20(1)    ------>MYB46(1)         <----------------
            --------->AHL25(3)       --------->AHL20(1)   <---------ALFIN1      <---------ATHB12
            <---------AHL20(1)       --------->AHL25(2)  --------->MYB46(3) ------------>CBF
            --------->AHL20(1)      --------->AHL12(2)   <---------MYB55(2)>>>>>>>>>>>>>>>>>LFY
--->LBD16  <---------AHL20(2)       <---------AHL12(3) <---------TCP20--------->DOF5.7(2)
>NtERF2    <---------AHL12(3)       <---------AHL12(2) <---------TCP15(1) --------->ZAT6  <---------
-->LBD16   --------->AHL12(3)       --------->AHL12(3) --------->PCF2--------->TOE2(3) <-----------GT1
--LBD16  <-----------TBP   <---------MYB46(3)<---------YAB5------>MYB83 <---------DOF5.7(2)   <-----
 
ctctaaatacttatatatatttttatttgtttgttcgaaaaatatttaatcaattttggacccacccttcttcgttaacaccaatgtttttttctttctt  49400
                                   --------->AHL20(1)
                                   --------->AHL25(2)                 <-----------GT1
                                   <---------AHL20(1)             --------->AHL12(1)
                                   --------->AHL20(3)             <---------AHL20(2)
                                   <---------AHL20(3)             --------->AHL25(1)
                                   <---------AHL25(3)             <---------AHL12(1)
                                   <---------AHL25(2)             --------->AHL12(3)
                                   <---------AHL25(1)             <---------AHL25(3)
                          <------ZmHOX2a(2)                       --------->AHL20(2)
                         --------->GATA12                         <---------AHL25(1)
                         <---------ARR14(2)                       <---------AHL12(3)
                         --------->AGP1                          --------->AHL12(1)
                         --------->RVE1(2)                       --------->AHL25(2)
                         <---------GATA12                        --------->AHL20(1)
                         <---------ARR11(2)                      --------->AHL12(3)
                         --------->ARR11(2)                      <---------AHL20(2)
                         --------->ARR14(2)                      --------->AHL20(2)
                     --------->CCA1(2)                           <---------AHL20(1)
                     <------ZmHOX2a(2)                           --------->AHL20(3)
                     --------->ARR14(1)                          --------->AHL25(1)
                    --------->ARR11(3)                           <---------AHL25(3)
                    --------->AGP1 --------->AHL20(2)            --------->AHL25(3)
                    --------->RVE1(2)                            <---------AHL25(2)
                    <---------GATA12                             <---------AHL25(1)
                    --------->GATA12                             <---------AHL20(3)
                    <---------ARR11(3)                           <---------AHL12(1)             ----
                    --------->ARR11(2)                          --------->AHL12(2)             <----
                    <---------ARR11(2)                          <---------AHL12(2)             <----
                    <---------ARR14(2)                         <---------WOX13(2)             <-----
            --------->WOX13(2)     <---------AHL12(2)          --------->AHL12(2) --------------->AGL15
--------ANAC81      --------->ARR14(2) <---------YAB5          --------->WOX13(2) <---------------AGL15
-DOF2<---------CCA1(2)------>ZmHOX2a(2)<---------YAB1      --------->YAB1   <----------DOF2  -------
-----DOF2   <---------WOX13(2)    --------->YAB1<---------ANAC55(2)<---------AHL12(2)    -----------
 
ttcatttcatctcttaatttcaagatccgatctacaaatataatccttgttaagtatgctcaacataatttattttcttctttaactcgaattggttaat  49500
                                                       --------->AHL20(3)
                                                       <---------AHL20(2)
                                                      --------->AHL20(2)
        --------->YAB5                   ----------->GT1
        --------->YAB1      ------>ZmHOX2a(2)      --------->TOE1(3)
       <---------YAB5      --------->At4g35610     --------->YAB1
----->YAB5                <---------ARR11(3)       --------->TOE2(3)
-----YAB5                 --------->ARR11(3)    <-----------GT1                        <---------WOX13(2)
-----ATHB12      <-----------GT1         --------->At4g35610                           --------->WOX13(2)
----WOX13(2)  <---------WOX13(2)         <---------At4g35610                     <----------DOF2
-->WOX13(1)   --------->WOX13(2)       <-----------RAV1(2)                      <---------ANAC58
>GT1   --------->ICU4     <---------GATA12     <---------KAN1 <-----------GT1   <---------ANAC58  <-
 
caatagtggaatcatcaaattaacaaaatgatctgaacaaattcaggtgaataaccataaaattctaaccatttagaaatatggcttttcaattgagttt  49600
          <---------MYB52(1)
       ------>ZmHOX2a(2)
       <-------TEIL<---------TOE2(3)
      <------ZmHOX2a(2)
     --------->ARR14(2)
     --------->GATA12--------->GATA12
     --------->AGP1<---------TOE1(3)
     <---------GATA12<---------RVE1(2)
     <---------ARR14(2)
     <---------RVE1(2)
     --------->ARR11(2)                     <----------DOF2                   <----------DOF2  -----
     <---------ARR11(2) ----------->GT1  <---------ARR11(3)               <---------MYB111(1)-------
   ----------->ARR10 --------->ARR11(3)  --------->ARR11(3)           <-------TEIL       ---------->DOF2
--------TOE2(3)<----------DOF2<---------AHL20(2)         <--------P <---------GATA12--------->ZAT6
 
taagaatagatccgttttctttaagatttgtatataatcccataaatcttttgttatcaggtagagctatagatgcaactacttttgactctaaaagaaa  49700
                                            <---------YAB1
                                          --------->YAB1
                                         <---------YAB1
                                        <---------AHL12(2)
                                        --------->AHL20(3)
                                        <---------AHL20(3)
                                        --------->AHL25(2)
                                        <---------AHL25(2)
                                       <---------ICU4
                                       -------->ATHB1
                                      --------->AHL25(1)
                                      <---------AHL25(1)
                                      <---------AHL25(2)
                                      --------->AHL25(2)
                                      <---------ATHB51
                                      --------->AHL25(3)
                                      <---------AHL20(3)
                                      --------->AHL20(3)
                                      <---------AHL12(1)
                           <---------MYB52(1)
                       -------->P     --------->AHL12(1)
                       ------>MYB46(1)--------->ICU4  --------->AHL20(2)
                       ------>MYB83   <---------AHL20(2)
                ------>MYB46(1)       --------->AHL20(2)<-----------GT1
                ------>MYB83         --------->AHL12(2)<---------AHL20(2)
       --------->AHL20(2) <-------GAMYB<---------AHL25(3)    ------>ZmHOX2a(1)
<---------WOX13(2)    ------>ZmHOX2a(1)--------->YAB1--------->AHL12(2)                          ---
------>GT1    --------->TOE2(3)      --------->WOX13(2)<---------AHL25(3)             ------>ZmHOX2a(1)
--->DOF2      <---------MYB59        <---------WOX13(2)<---------AHL25(1)       <<<<<<<<<MYB2    ---
 
gaaaattgaatttaaaacctaattcctaccgttactactaaattattatgaaacatatttaatcctctaaacaacattttttggttttcctatttctctt  49800
<- Previous    Next ->

AGI:  At1g01090.1   
Description:  PDH-E1 ALPHA (PYRUVATE DEHYDROGENASE E1 ALPHA); pyruvate dehydrogenase (acetyl-transferring). similar to AT-E1 ALPHA (pyruvate dehydrogenase complex E1 alpha subunit), pyruvate dehydrogenase (acetyl-transferring) [Arabidopsis thaliana] (TAIR:AT1G59900.1); similar to unknown [Populus trichocarpa] (GB:ABK95003.1); contains InterPro domain Dehydrogenase, E1 component; (InterPro:IPR001017)
Range:  from: 47485    to: 49286    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version