AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                      ------>NtERF2
                                                                                     --------->DEAR3(1)
                                                 <---------AHL12(2)                  --------->RAP2.3(3)
                                                 <---------YAB1                     --------->ERF1
                                                <---------AHL25(2)                 --------->At4g35610
                                                <---------AHL20(3)                --------->DEAR3(1)
                                                --------->AHL20(3)            --------->MYB46(3)
                                                --------->AHL25(2)          --------->GATA12
                                                --------->AHL12(3)          <---------GATA12
                                                --------->AHL12(2)          <---------ARR14(2)
                                               <---------ICU4               <---------ARR11(2)
                                               --------->YAB1               --------->RVE1(2)
                                             --------->AHL12(2)             ------->TEIL
                                          <----------DOF2                   --------->ARR11(2)
                     <---------At4g35610  <---------DAG2               --------->MYB52(1)     ------
                     --------->At4g35610  <---------DOF5.7(1)      --------->ANAC46--------->ZAT14
    --------->KAN1   <---------ZAT2 <---------GLK1(1)              --------->ANAC58<---------At4g35610
------->LBD16        --------->ZAT2 --------->GLK1(1)     ---------->DOF2   --------->ARR14(2)------
------->At5g28300   ----------->RAV1(1)  <---------DOF5.7(1)       --------->ANAC58--------->ABI4(1)
-->ZAT18    <---------At4g35610---------->DOF2<---------YAB1     <---------ALFIN1--------->ANAC46
 
ccgtgaaacagtcgctgcttctccagcagaactcaaaagaattccctttattattattcacaaaagcctcacccaaacgaatccaccgcagccaaaacct  37400
                                    <---------YAB5
                                   <---------ARR11(1)
                                --------->ANAC55(2)
                                <---------ANAC55(2)
                                <---------ANAC58
                               <-------TEIL
                             <---------GATA12
                             --------->ARR14(2)
                             --------->GATA12
                             --------->ARR11(2)                          <---------AHL20(2)
          --------->RVE1(2)  <---------GLK1(2)                           --------->KAN1
  --------->GATA12           <---------ARR11(2)                        <---------WOX13(2)
  <---------ARR11(3)         <---------ARR14(2)                        --------->WOX13(2)          -
  --------->ARR14(2)        --------->KAN1                            ----------->GT1             --
  --------->ARR11(3)   --------->YAB1                             <---------GATA12              ----
  <---------ARR14(2)  <---------ATHB12                            --------->GATA12              <---
  <---------GATA12    --------->MYB46(3)   <---------YAB1       <---------TOE2(3)               <---
 <---------CCA1(2)  --------->WOX13(1)   --------->KAN1      <---------WOX13(2)    --------->HSFB2a(2)
--->TOE1(3)       <---------ATHB12<---------CCA1(2)      <---------At4g35610       <---------HSFB2a(2)
--->TOE2(3)       <---------YAB5<---------ANAC58  <----------DOF2 --------->ARR11(3)            ----
 
tcacaaatcttcatatcagtaatcaatcaccagattcgtatcatttatgctaacttttagagctaataagatttagttaatcgcttctataagtttctca  37500
            ======================HOX2a_HOX2a
            ============================HOX2a_HOX2a
            ------>ZmHOX2a(2)
           =============================HOX2a_HOX2a
           <------ZmHOX2a(2)
           =======================HOX2a_HOX2a
          <---------ARR11(3)
          --------->ARR11(3)
          --------->AGP1
          --------->GATA12
         <---------GLK1(1)
         --------->GLK1(1)
   --------->MYB52(1)
-------->At4g35610
------->RAP2.6(2)                                ----------->GT1
----->ZAT2<---------GATA12       ------>ZmHOX2a(1)                                        --------->ANAC58
------At4g35610                  <---------HSFB2a(2)                                      --------->ANAC58
------ZAT2<---------RVE1(2)      --------->HSFB2a(2)    ----------->GT1              <----------ID1
----->At4g35610            <------ZmHOX2a(1)--------->YAB1   <-----------GT1        <------ZmHOX2a(1)
 
gcagccaaacagagatcttagtatgttataggaatcctagaaactgctcataatgtaaactgttatacccttgagagtagccatggaggagacaagtatg  37600
                                                                                               <----
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->YAB1
                             --------->LBD16               --------->GATA12        --------->RVE1(2)
                            --------->LBD16                <---------GATA12      --------->GLK1(2)
                            --------->ANAC46        <---------AHL12(1)           --------->RVE1(2)
                           --------->LBD16          --------->ICU4              --------->CCA1(1)
                           <---------LBD16          --------->AHL12(1)          --------->RVE1(1)
                           --------->HSFB2a(2)      --------->AHL25(1)         <---------AHL12(1)
                      --------->GLK1(1)        --------->LBD16                 --------->AHL12(1)
                  --------->LBD16             --------->LBD16                  <---------AHL25(3)
                 <---------LBD16              --------->ANAC46                --------->AHL12(3)
                <---------LBD16               --------->HSFB2a(2)             --------->AHL25(2)
             ----------->HVH21               --------->HSFB2a(2)              <---------AHL25(1)  --
           <---------At4g35610               <---------LBD16                  <---------AHL12(2)  <-
           --------->At4g35610               <---------HSFB2a(2) --------->ANAC58--------->ARR11(3)
         --------->YAB1    <---------HSFB2a(2)<---------HSFB2a(2)--------->ANAC58<---------ARR11(3)
        <---------YAB5<---------GLK1(1)<---------YAB5--------->YAB1           --------->AHL20(2) ---
 
caatctgacttatcatctcaccgggaactccccggagaagtcatcgttcccggaaataatcaaatcggaagcaaaacaaaaaaaaatctctaaaaataaa  37700
   --------->MYB52(1)
-----WOX13(2)
-----AHL12(2)
----AHL12(2)
--->AHL12(3)
--->AHL25(2)
----AHL12(3)
---AHL25(3)
-->AHL12(1)
---AHL12(1)
-->AHL25(1)
-->AHL12(3)
---AHL12(3)
---AHL20(2)
-->AHL25(2)
---AHL20(1)
-->AHL20(2)
---AHL25(2)
-->AHL25(3)
-->AHL20(1)
---AHL25(1)
->AHL25(3)
->AHL20(2)
--AHL20(2)
->AHL12(3)
->AHL12(1)                                           >>>>>>>>>TBF1
--AHL12(3)                                     >>>>>>>>>TBF1  >>>>>>>>>TBF1
--AHL25(1)                                  >>>>>>>>>TBF1  >>>>>>>>>TBF1
->AHL25(1)                               >>>>>>>>>TBF1  >>>>>>>>>TBF1
--AHL12(1)                              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
-AHL12(2)                             >>>>>>>>>TBF1------------------------>ANAC81
>AHL12(2)                            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
------->AHL20(2)                   >>>>>>>>>TBF1  >>>>>>>>>TBF1
--------AHL20(2)           --------->MYB52(1) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
------>AHL20(2)          <---------ARR11(3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<---------TOE2(3)
 
tttaaaaaacagagagaagaaggaagaagataactgaagaagaagaagaagaagaagaagaagaagaagaaggaagactgttttaggctgaagaagactg  37800
                                                                           ----------->GT1
                                                                     <---------WOX13(1)
                                                                    --------->WOX13(2)
                                                                    <---------WOX13(2)
                                                                    <------------CBF
                                                                  <---------YAB1
                                                                  <---------AHL20(2)
                                                                 <---------AHL12(3)
                                                                 <---------AHL20(2)
                                                                 --------->AHL12(3)
                                                                 --------->AHL25(2)
                                                                 <---------AHL25(1)
                                                                 --------->AHL25(3)
                                                                 <---------AHL25(2)
                                                                 --------->AHL20(2)
                                                                 --------->AHL25(1)
                                                              <---------AHL12(2)
                                                              <---------AHL25(2)
                                                              --------->AHL12(1)
                                                              <---------AHL12(1)
                                                              <---------AHL12(3)
                                                              --------->AHL25(2)
                                                              <---------AHL20(3)
                                                              --------->AHL20(3)
                                                             --------->AHL12(2)
                                                             <---------AHL12(1)
                                                             --------->AHL12(1)
                               ----------->RAV1(1)           <---------AHL12(3)
            --------->ANAC58   --------->RAP2.6(2)           <---------AHL25(2)
            --------->ANAC58--------->ANAC46                 --------->AHL12(3)
   >>>>>>>>>TBF1   --------->ANAC58       <-----------GT1   --------->AHL12(1)                  ----
>>>>>>>>>TBF1      --------->ANAC58    *TSS                 --------->AHL25(3)       <---------TOE2(3)
 
gaagaagaagaagagaagccagaagcaatctcagccacaacaatttttcccctaatttttggaaaaattttaattgaaaagtttatttgaggctggaaca  37900
                                                  --------->ARR11(3)
                                                  <---------RVE1(2)
                                              ----------->GT1
                                             --------->ALFIN1
                                            ------->MYC3
                                            <-------MYC3
                                            ------->MYC4
                                            <-------PIF5
                                            ------->PIF5
                                            ------->MYC2
                                            <-------MYC2
                                            <-------MYC4
                                           --------->TGA1a
                                           <---------O2                    <----------DOF2
                                           <---------ANAC55(2)             <---------DOF5.7(1)
                                           --------->ANAC55(2)             <---------DAG2
                                           --------->O2                  --------------->AGL15
                                           ===========================================bZIP_DOF
                                           <---------TGA1a               <---------------AGL15
                                          ------------>OsbHLH66         <-----------------AG
                                    --------->RVE1(2)                  <---------ZAT18
                                    --------->GATA12                   --------->ZAT18
                                    <---------GATA12                   --------->ZAT14
                                    <-----------ARR10                  <---------ZAT14          <---
                                    --------->ARR14(2)               --------->ANAC46--------->ARR11(3)
                                    <---------ARR14(2)              --------->At4g35610         <---
             ----------->GT1        <---------ARR11(2)            --------->ZAT14    --------->RVE1(2)
        ----------->TBP             --------->ARR11(2)            --------->ETT(2)   <---------ARR11(3)
    ----------->GT1--------->MYB52(1)    <---------ALFIN1         <---------ETT(2)  <---------KAN1
----->At4g35610   --------->DOF5.7(1)<------ZmHOX2a(2)            <---------ZAT14   <---------CCA1(2)
 
gcaccaagggtataaatggaaaaaacagaagtcatcgcagatcgacacgtggtgatattgtagtggctgtctactgcactttttggtatatctcaagttg  38000
                                         --------->DOF5.7(1)                         ---------------
                                         --------->DAG2  <---------ZAT18             <--------------
                                        ---------->DOF2  --------->ZAT18         --------->ICU4
                                    <------MYB83  <---------AtMYB61              <---------YAB1
                                    <------MYB46(1)     --------->PCF5         --------->YAB5
                                   <---------TOE1(2)  <---------MYB46(3)    <---------DOF5.7(2)
                                   <---------TOE2(2) <---------AtMYB61     --------->ARR11(2)
                                --------->ANAC46  --------->ALFIN1         <---------ARR11(2)
                                <---------ANAC55(2)  --------->ALFIN1    --------->REM1(2)
                                ===================bZIP_DOF           <---------ANAC55(2)
                                --------->TGA1a  <---------ZAT14      <---------ANAC46
                           --------->At4g35610   --------->ZAT18      --------->ANAC55(2)
              <---------HSFC1(2)--------->O2     --------->ZAT14      <---------ANAC58
         <-----------RAV1(2)    --------->ANAC55(2)<---------ANAC46   <---------ANAC55(1)
      --------->ANAC46     <---------At4g35610<---------ANAC58        <---------ANAC58
------ANAC58  --------->HSFC1(2)<---------TGA1a --------->ALFIN1  <---------ANAC58<---------KAN1
------ANAC58<---------GLK1(2)   <---------O2  <---------ANAC58    <---------ANAC58--------->ATHB12
 
cttctctacgagccagaagcttcaatgtgaagctcacgtaggtaaaagtgagtgtggtggtccacaattgcttacgtgtaaacgattattggtacaaact  38100
                          --------->At4g35610
                          <---------At4g35610
                          --------->ZAT2
                         ------>NtERF2
                        <---------ATERF1(2)
                        --------->ATERF1(2)
                        <-----------RAV1(2)
                       <------NtERF2                           --------->ARR11(2)
                       --------->ATERF1(1)                     <---------ARR14(2)
                      ------>NtERF2                            <---------ARR11(2)
                      --------->ABI4(2)                        --------->ARR11(3)
                  <---------DEAR3(1)             <---------ARR14(2)
                 <-------TEIL                    <---------ARR11(2)
                 --------->SPL7(1)               --------->ARR14(2)   <---------ANAC58
               <---------PCF2                 --------->ANAC55(2)     <---------ANAC46
               <---------ARR11(2)             <---------ANAC55(2)------>ZmHOX2a(2)
               <---------ARR14(2)    <---------ZAT14           --------->GATA12
              <------MYB46(1)        --------->ZAT18           <---------ARR11(3)
              <------MYB83<---------ZAT2      <---------ANAC46 --------->ARR14(2)
             <---------MYB46(3)      --------->ZAT14           <---------RVE1(2)                   <
             <---------------AtSPL3<---------------AtSPL3      <---------AGP1                      <
 --------->YAB5<---------SPL7(1) <---------AtMYB61    <---------RVE1(2) ----------->GT1         <---
>AtSPL8      <---------------AtSPL8<---------------AtSPL8      <---------GATA12  --------->ARR11(3)<
-AtSPL8     --------->ALFIN1  ----------->HVH21  --------->ARR11(2)   <---------ANAC58         <----
 
tggacgactaaacaagtgggtacggtgccagctgtgatggtgtactgctacgtattggctatgctggatctgggcttgtaataagacattgtatgggcct  38200
                                <---------YAB1
                                <---------TOE2(3)
                               <-----------GT1
                         --------->ANAC55(2)
                         <---------ANAC58
                         <---------ANAC46
                         <---------ANAC58                                                   --------
                   <---------AHL20(2)                                                       --------
                   <---------AHL20(3)                   --------->ZAT2                      <-------
                  <---------AHL25(3)                   --------->ANAC58                  <---------AHL20(3)
                 --------->AHL12(3)                    --------->ANAC58                  <---------AHL20(2)
                 --------->AHL20(2)               --------->ANAC46             <---------ANAC46
                 <---------AHL20(2)               <---------ETT(1)       <---------ARR14(2)---------
    --------->ANAC46--------->WOX13(2)        <-----------GT1         --------->LBD16    <---------AHL25(1)
----------DOF2   <---------AHL12(3)         --------->AHL25(1)       <---------LBD16     --------->AHL20(3)
---------DOF5.7(1)--------->AHL25(3)        --------->AHL20(2)      <---------LBD16      --------->AHL12(3)
------ALFIN1     --------->AHL25(3)         <---------AHL25(1)   <---------ZAT2<---------ANAC58
---------DAG2    <---------AHL25(1)       <---------WOX13(2)     <---------ZAT14        --------->YAB1
--NtERF2         --------->AHL25(1)       --------->WOX13(2)     --------->ZAT2<---------ANAC58
 
cacttttacgcctattctatataaatttgcgtattaacatagttgaattaaacccgacaagcttggactgctcggggaacttgcgtctgtataaaaatct  38300
<- Previous    Next ->

AGI:  At1g01060.1   
Description:  LHY (LATE ELONGATED HYPOCOTYL); DNA binding / transcription factor. similar to CCA1 (CIRCADIAN CLOCK ASSOCIATED 1), transcription factor [Arabidopsis thaliana] (TAIR:AT2G46830.1); similar to late elongated hypocotyl [Castanea sativa] (GB:AAU20773.1); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 33666    to: 37840    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version