AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                        --------------->AGL15
                        <---------------AGL15
                        --------->TOE1(3)
                        --------->TOE2(3)
                       <-----------------AGL1
                       ----------------->AG <---------YAB5                            --------->ANAC46
                       <-----------------AGL2                                   <---------ATHB12
         <---------GATA12                   <---------KAN1                     --------->RVE1(2)
         --------->GATA12   --------->WOX13(2)                                 --------->GLK1(2)
------->ARR11(3)       ----------------->AGL2                            --------->DOF5.7(1)
--------RVE1(2)   --------->YAB1           --------->GLK1(2)             --------->DAG2
------>YAB1      <---------YAB1    <------NtERF2                        --------->DOF5.7(1)
-----WOX13(1)  --------->YAB1<---------WOX13(1)      <---------ATHB12   ---------->DOF2
-->ATHB12--------->RVE1(2)  <---------WOX13(2)--------->WOX13(1)<---------AHL20(2)    --------->PCF2
--ATHB12 ------->TEIL  <-----------------AG--------->RVE1(2)   --------->AHL20(2)--------->YAB1
 
tgatattgactgaatctaacatcataaccctaattggcagagagagaatcaatcgaatcaagagtattaaatggaaaaagcgaatcaagaccccacaagg  32800
                                                                                                 ---
                                                                                                 <--
                                      --------->WOX13(2)                                   ---------
                                      <---------WOX13(2)        --------->ARR11(2)         ---------
                                 --------->ANAC58               ------->TEIL               <--------
                              --------->KAN4(2)                 <---------ARR11(2)         ---------
            <---------At4g35610  --------->ANAC58            --------->ANAC55(2)           ---------
         ---------->DOF2     --------->YAB1                 <---------TOE1(3)             ------>MYB46(1)
       ------>ZmHOX2a(1)    <------ZmHOX2a(2)      --------->ARR11(3)                     ------>MYB83
       ============================HOX2a_HOX2a     <---------AHL20(1)                   <---------MYB59
       ========================HOX2a_HOX2a        <---------CCA1(2)--------->YAB5      -------------
      --------->TOE1(3) <------ZmHOX2a(2)      <-------TEIL <---------TOE2(3)          -------------
      --------->TOE2(3)--------->GATA12   <---------TOE2(3)<---------DOF5.7(2)--------->DOF5.7(1)<--
     --------->YAB5    <---------GATA12<---------ATHB51  --------->DOF5.7(2)---------->DOF2<--------
 
gaaaacaatccttaaagcagacttgagatcgatcatacccaaattatggattcatatattgttaacgtatcgattactgaaaagatgtataccaaatctg  32900
  <---------DOF5.7(1)
 <---------DOF5.7(1)
 <---------DAG2
 <----------DOF2                      --------->ANAC58
------>ZAT14                          --------->ANAC58
-------ZAT18                     --------->CCA1(2)
>ARR14(2)                       <---------RVE1(2)
>GLK1(2)                        --------->GATA12
-ARR14(2)                       <---------GATA12
>RVE1(2)                      <---------TOE2(3)                         --------->ANAC58
>GATA12                    <---------WOX13(1)                         ---------->DOF2      ------>ZmHOX2a(2)
---->AG                  --------->ATHB12           <---------HSFB2a(2) --------->ANAC58 <---------ARR11(3)
---->AGL1                --------->YAB5  ----------->RAV1(1)   <---------YAB5            --------->ARR11(3)
-------ZAT14            <---------YAB1--------->ANAC46      --------->AHL20(2)    <----------DOF2
-GATA12              <---------MYB46(3) <----------ID1   --------->YAB5--------->DAG2--------->YAB1-
 
ttcactttttctctatagactcgatggatgattgagatttgaagcaacaaaatacccagaagattaaacatggaaaagcatcaaactttgatgatcttag  33000
                                          --------->MYB46(3)
                                         ---------->DOF2
                              --------->ARR11(2)
                              <---------ARR11(2)                          --------->YAB5
                              --------->GATA12                         --------->YAB1
        ----------->GT1       <---------GATA12  <---------MYB52(1)    --------->ICU4
      ---------->DOF2 ------->TEIL   --------->ANAC58                --------->ANAC58
  --------->YAB5--------->DOF5.7(1)  --------->ANAC58       <----------DOF2
-------->YAB5 <---------AHL12(2)------>ZmHOX2a(2) <---------MYB46(3) --------->ANAC58        -------
 
aacgatgacaaaagaaaaaaaaacgtacctttggatcgaaacgaaacagccgattgttgttttctttatcgcaaggatgatgaagaaactttgggagaga  33100
                                                                  --------->RVE1(2)
                                                                  <---------GATA12
                                                               --------->ANAC55(2)
                                                               --------->ANAC46
                                                               --------->ANAC55(1)
                   <---------STY1(2)                          <---------LBD16
                   --------->STY1(2)                       --------->CCA1(2)                     <--
                  --------->ANAC58                         --------->KAN1                        <--
             <------MYB46(1)                              --------->ARR11(3)                 -------
             <------MYB83   ----------->GT1         *TSS  <---------ARR11(3)       <---------YAB1---
            <---------AtMYB61                      <---------ALFIN1<------ZmHOX2a(2)--------->YAB1
           <---------MYB52(1)         ------->TEIL --------->DEAR3(1)              <---------TOE2(3)
   ---------->DOF2--------->ANAC58 ----------->GT1 --------->AtMYB61            <---------AHL20(2)--
---->GT1  <-------GAMYB  --------->ATHB12         --------->MYB46(3)     <----------DOF2 --------->ZAT6
 
aacaagtgaagcccgttggtctagcaagtgattgtaaaatgtatatatgagtcaccaccgagatatacggatcaaacttttatattatcgtaacactcac  33200
             <---------AHL12(2)
            <--------HAHB4
            -------->ATHB1
            <---------AHL25(3)
            --------->ATHB51
            <---------AHL20(2)
            --------->AHL20(2)
           --------->AHL25(3)
           <---------ATHB12
           <---------ATHB51
           --------->ICU4
          --------->WOX13(2)                               --------->ANAC55(2)
          <---------WOX13(2)                               --------->ANAC58
       ------------>CBF                                    <---------ANAC55(2)
      --------->ANAC58    <-----------GT1                  --------->ANAC58
      --------->ANAC58  --------->CCA1(2)                <-----------GT1
      --------->ANAC46 <---------ARR11(3)            <---------AHL20(2)
    --------->ZAT6     --------->ARR11(3)            <---------YAB1                        ------>ZmHOX2a(1)
-------ZAT14--------->AHL25(1)                      <---------AHL12(2)               --------->KAN1
-------ZAT18<---------AHL25(1)               <---------DAG2--------->ANAC46        <-----------HVH21
-->YAB5<---------ATHB12<---------GATA12      <----------DOF2    --------->YAB1   <---------ANAC58
------>ZAT14--------->AHL12(1)  <----------DOF2  --------->AHL12(2)              <---------ANAC58
------->ZAT6<---------AHL12(1) <---------DOF5.7(1)  --------->AHL12(2)           <---------RAP2.6(2)
 
tacactaccactcaattatttacaaagatttacatctttttaaaaatactttattttttattacgaaacatagtttgtgtttttgcggtcactcctataa  33300
                                          <------MYB46(1)
                                          <------MYB83
                                         <---------MYB46(3)
                                         --------->MYB111(2)
                                         --------->MYB111(1)                                 <------
                                         <---------AtMYB61                                   <------
                                         --------->MYB46(2)                            <-----------ARR10
                                         --------->MYB59                               --------->ARR14(2)
                                     <------MYB83                                      --------->RVE1(2)
                                     <------MYB46(1)                                   <---------ARR14(2)
                                --------->AHL20(1)                                     <---------ARR11(3)
                                <---------AHL20(2)                                     --------->ARR11(3)
                                --------->AHL20(2)                                    <---------CCA1(2)
                                <---------AHL25(1)                                ----------->GT1
                                --------->AHL25(2)                            --------->AHL20(2)
                                <---------AHL12(1)                            --------->AHL20(1)
                                <---------AHL25(3)                            --------->AHL12(1)
                                <---------AHL25(2)                            <---------AHL25(3)
                                --------->AHL12(1)                            <---------AHL20(2)
                               --------->AHL25(3)                             <---------AHL12(1)
                               --------->AHL12(1)           --------->KAN1    <---------AHL25(2)
                               --------->AHL20(2)    <---------KAN1           --------->AHL25(2)
         <---------ANAC58      <---------AHL20(2)    --------->CCA1(2)        <---------AHL25(1)
         <---------ANAC58      <---------AHL12(1)   --------->ARR11(3)       <---------AHL25(2)
      <---------ARR14(2)       <---------ATHB12     <---------ARR11(2)       --------->AHL25(3)
      <---------ARR11(2)       <---------AHL25(1)   <---------RVE1(2)        --------->AHL20(2)
      --------->ARR14(2)       --------->AHL12(3)   --------->ARR11(2)       --------->AHL25(2)
      --------->ARR11(2)       <---------ATHB51     --------->ARR14(2)       --------->AHL25(1)
     <------ZmHOX2a(1)         --------->AHL25(1)   <---------ARR14(2)       --------->AHL12(3)   --
 
tctatgtaggatacttgcattacatttttcacaaataatttggtttggtagcaaggatatggctcattcagtgagaacaaaaaaattgtatatctactca  33400
                      ----------->GT1
            --------->WOX13(2)
           ------>MYB83
---ATHB12  ------>MYB46(1)               <---------STY1(2)                  <---------ANAC55(2)
---YAB5  <---------------AGL15           --------->STY1(2)   <----------DOF2--------->ANAC55(2)
------->YAB1<---------WOX13(2)----------->GT1               <---------DOF5.7(1)       <---------YAB1
 
ttcatcagtaaaccaaattaagagattgaaatattgtataaactagctacacaatataagccttctttaggcctctattacttaagcttgtaatagggaa  33500
                                                                               ------->GAMYB
                                                                              --------->MYB46(3)
                                                                      <---------MYB52(1)
                                  <----------DOF2                    <-------GAMYB
                                 --------->YAB5                     <---------ANAC58
                               <---------ARR11(3)                   <---------ANAC58
                               --------->ARR11(3)              <---------KAN1 <---------MYB52(2)
                     <---------ANAC46                  <----------DOF2--------->ALFIN1
                     <---------ZAT6  ---------->DOF2  <---------DOF5.7(1)  <---------WRKY38(1)
      <---------REM1(1)  ----------->GT1              <---------DAG2<---------ANAC46               <
 
aatgttgtaatgtaggcccaagtagtgtgagtaaaatctttaaggcccagcctagcacctttgggcatttggcgttgggcaacgagcgccttcaagtttg  33600
                <---------ICU4                                                        <-----------GT1
               --------->ICU4                                                     --------->YAB1
               <---------YAB1                                                    <---------YAB1
             --------->YAB5                                                    --------->YAB1
             --------->YAB1                                                    <--------HAHB4
             <---------ICU4                                                    <---------ICU4
             <--------HAHB4                                                    --------->YAB5
             -------->ATHB1                                                   <---------YAB5       -
            --------->ICU4                               <----------DOF2      <---------YAB1     ---
            <---------YAB5         <---------------------WRI1 <-----------GT1<-----------GT1     <--
           --------->GLK1(2)   ---------->DOF2     ----------->GT1          --------->YAB1     <----
 --------->MYB52(1)          --------->AtMYB61     <---------REM1(1)     <----------DOF2       <----
---------MYB52(2) <---------YAB1 --------->DOF5.7(1)  <-----------GT1   <---------DOF5.7(1)  -------
 
aaacaaacagagagaatcattatgaagaaacaccaaaagacaaaactttctaagttgtaacttttgtacagttcatcttttatcattataaactatttat  33700
<- Previous    Next ->

AGI:  At1g01050.1   
Description:  ATPPA1 (ARABIDOPSIS THALIANA PYROPHOSPHORYLASE 1); inorganic diphosphatase/ pyrophosphatase. similar to ATPPA3 (ARABIDOPSIS THALIANA PYROPHOSPHORYLASE 3), inorganic diphosphatase/ pyrophosphatase [Arabidopsis thaliana] (TAIR:AT2G46860.1); similar to unknown [Populus trichocarpa] (GB:ABK94595.1); contains InterPro domain Inorganic pyrophosphatase; (InterPro:IPR008162)
Range:  from: 31170    to: 33153    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g01060.1   
Description:  LHY (LATE ELONGATED HYPOCOTYL); DNA binding / transcription factor. similar to CCA1 (CIRCADIAN CLOCK ASSOCIATED 1), transcription factor [Arabidopsis thaliana] (TAIR:AT2G46830.1); similar to late elongated hypocotyl [Castanea sativa] (GB:AAU20773.1); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 33666    to: 37840    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version