AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                           <---------AHL12(3)
                           --------->AHL12(3)
                           --------->AHL20(3)
                           <---------AHL20(2)
                       <---------AHL20(2)
                      --------->AHL25(3)
                      <---------YAB1
                     --------->AHL20(3)
                     <---------AHL20(3)
                     <---------AHL25(2)
                     <---------AHL12(3)
                     --------->AHL12(3)
                   <---------YAB1
                   <---------AHL12(2)
                  <---------AHL12(2)
                  --------->AHL12(2)
                  <---------AHL25(2)
                  <---------AHL25(3)
                  --------->AHL12(3)
                  <---------AHL12(3)
                  --------->AHL25(2)
                  <---------AHL20(3)
                  --------->AHL20(3)
                 --------->AHL20(2)
                 <---------ICU4
                 --------->ATHB51
                 <---------AHL12(1)
                 --------->AHL12(1)
                 --------->AHL25(1)
                 <---------AHL20(2)
                 --------->AHL25(3)
                 <---------AHL25(3)
                 <---------AHL25(2)
                 <---------AHL25(1)
                 --------->AHL12(3)
                 <---------AHL12(3)
                --------->ICU4
                --------->AHL25(3)
                <---------YAB5
                <---------YAB1
               <---------AHL12(2)
               --------->AHL12(3)
               <---------AHL25(2)
               --------->AHL12(2)
               <---------AHL12(3) <---------YAB1
               --------->AHL25(2)--------->AHL20(3)
              --------->YAB5     <---------AHL20(2)
              --------->YAB1 <---------AHL20(2)
              <--------HAHB4--------->AHL25(3)                        <---------KAN1
              <---------ICU4<---------YAB1                       --------->ANAC46
             <---------AHL12(1)  <---------AHL20(3)           <---------WRKY38(1)
             --------->AHL20(2)<---------YAB1                 --------->ZAT14
             --------->AHL25(3)<---------------AGL15          <---------ZAT14
             <---------KAN1<---------AHL25(2)                 --------->ETT(2)
             --------->ICU4<---------AHL20(3)              <------MYB46(1)
             --------->AHL12(1)--------------->AGL15       <------MYB83
     ----------->GT1 <---------AHL20(2)    --------->DOF5.7(1)<---------ETT(2)           <---------HSFB2a(2)
-TOE2(3)   --------->YAB1<---------YAB1  ---------->DOF2   <---------DEAR3(2)   ---------->DOF2
 
tttgaaaatagttagaataattatttttatttttatttttatgggaaagaagttgcacgagtcggtccacagaatgacagaacaaaagcattttagaagt  22700
               <---------ZAT14
             <---------YAB1
           --------->YAB1
           --------->YAB5
          <---------ATHB12
         ------>MYB83
         ------>MYB46(1)                      <-------TEIL
        --------->WOX13(1)             --------->ATHB12
      <---------MYB55(2)           <-----------ARR10
      --------->MYB46(3)           ------->TEIL
      <---------ATHB12             <---------ARR11(2)
     -------->P--------->ZAT14     <---------ARR11(1)                             <---------ANAC58
     ------>MYB46(1)               --------->ARR11(2)       <---------------AGL15 <---------ANAC58
     ------>MYB83                  --------->ARR14(2)      --------->WOX13(2)     <---------ANAC46
     --------->ANAC58              <---------ARR14(2)     <---------AHL20(2)   --------->DAG2
     --------->ANAC58              --------->RVE1(2)   <---------AHL12(2)     --------->DOF5.7(1)
   <---------MYB111(1)            <---------CCA1(2)    --------->AHL12(2)     ---------->DOF2
   --------->AtMYB61              <---------ARR14(1)   --------->YAB1     --------->At5g28300 ------
  --------->DEAR3(2)           --------------->AtSPL8 <---------KAN1     ----------->GT1 <---------KAN1
  --------->MYB46(3)        --------->KAN1 <---------MYB46(3)   <---------AtLEC2--------->DOF5.7(1)
 
ttagaaccaaccaatcactatagttttccacttgtccgtatctcattggttcatcgaatattaacttacatggaaacagtaaaaagcgtggaataagtcg  22800
                                                            --------->YAB1
                                                            <---------AHL12(2)
                                                            <---------AHL25(3)
                                                            --------->AHL25(2)
                                                            <---------AHL25(1)
                                                            --------->AHL12(3)
                                                            --------->AHL20(2)
                                                 --------->YAB5
                                                 <---------ICU4
                                                <---------YAB5       <---------ARR11(3)
                                     <---------AHL20(2)   --------->AHL25(2)
                                     --------->AHL20(2)   --------->AHL20(2)
                                     <---------AHL20(3)   <---------AHL25(2)
                                     <---------AHL25(1)   <---------AHL20(3)
                                     --------->AHL25(1)   --------->AHL20(3)
                                     <---------AHL12(3)  --------->AHL12(2)
      --------->GATA12               --------->AHL20(3)  <---------AHL12(2)
      <---------GATA12               --------->AHL12(3)--------->AHL20(2)
     --------->GLK1(1)--------->ARR11(3)   <---------ANAC55(2)       --------->ARR11(3)
----->GT1             <---------ARR11(3)   --------->ANAC55(2) --------->RVE1(2)               <----
 
taaaactgaaatctaaaaatgaaaagatttcgatttcgatataaatacttaatctttataaaataatatcgaaatcttttcatttttagttttcagtttt  22900
                                <---------AHL25(1)
                                --------->AHL12(1)
                <---------AHL25(3)
                <---------AHL25(1)
                <---------AHL20(2)             <---------AHL12(2)
               <---------AHL25(3)              <---------WOX13(2)
               <---------AHL20(2)              --------->AHL12(2)
               --------->AHL20(2)          --------->HSFB2a(2)
               --------->AHL20(1) <---------AHL12(2)
               <---------AHL12(3)<---------AHL20(2)
               <---------AHL20(3)--------->AHL12(3)
               <---------AHL25(2)<---------AHL12(3)
               --------->AHL25(3)--------->AHL25(1)
               --------->AHL20(3)<---------AHL25(2)
               --------->AHL25(1)<---------AHL25(1)
               --------->AHL25(2)<---------AHL25(3)
             <---------WOX13(2) <---------AHL20(1)                                                 <
             <---------AHL12(2) --------->AHL12(3)                                                <-
            <---------AHL12(3)  <---------AHL12(1)                                                --
            <---------AHL20(3)  --------->AHL25(2)                                               <--
            --------->AHL20(3)  --------->AHL20(2)                                               ---
           --------->AHL20(2)   <---------AHL20(2)                                               ---
           --------->AHL12(1)   --------->AHL25(1)                   --------->LBD16             <--
           <---------AHL12(1)   <---------AHL25(2)          <---------ARR11(3)                   ---
           <---------AHL20(2)   <---------AHL25(3)          --------->RVE1(2)                    ---
     <---------ANAC58         --------->AHL12(2)            --------->ARR11(3)                   <--
     --------->ANAC55(2)      <---------WOX13(2)           --------->GLK1(1)                     <--
     <---------ANAC58      <---------MYB52(1)  --------->WOX13(2)  <---------LBD16           -------
<----------DOF2<---------AHL25(1)--------->AHL25(2)     <---------YAB1        --------->TOE1(3)  ---
<---------DAG2--------->AHL12(2)--------->AHL25(3)   --------->TOE2(2)    --------->KAN1  ----------
-------GT1 --------->AHL25(3) <---------AHL12(2)   <---------TOE2(3)<---------HSFB2a(2)  -----------
 
acacttttacttgataaatttaatacatctgttaattttttttcttctaaaattaacatatgatatctattcgggagataaccctaagaaaactgataaa  23000
                                   <-----------GT1
                                   <---------At5g28300
                                  <-----------GT1
                              --------->AHL25(3)
                              <---------AHL25(3)
                              --------->AHL12(1)
                              <---------AHL12(1)
                              --------->AHL25(2)
                              --------->AHL25(1)
                              --------->AHL20(2)
                              <---------AHL20(2)
                              --------->AHL12(3)
                              <---------AHL12(3)
                              <---------AHL25(1)
                             <---------AHL12(1)
                             <---------AHL25(1)
                             --------->AHL25(2)
                             <---------AHL25(2)
                             --------->AHL25(1)
                             --------->AHL12(3)
                             <---------AHL20(1)
                             --------->AHL20(2)
                             <---------AHL20(2)
                             --------->AHL25(3)
                             --------->AHL12(1)
                            --------->AHL12(2)
                           --------->AHL12(2)
                           <---------AHL12(2)
                          --------->AHL25(3)
                          --------->AHL25(1)
                          <---------AHL25(1)
         <----------DOF2  <---------AHL25(2)
---------AHL12(2)         <---------AHL20(1)
--------AHL25(3)          --------->AHL20(1)                      <------------CBF
------->AHL20(2)          <---------AHL20(3)                    <---------YAB1
-------AHL12(3)           --------->AHL20(3)                 --------------->AGL15
------>AHL25(1)           --------->AHL20(2)                --------->YAB1
------>AHL20(2)           <---------AHL20(2)               <---------YAB1
-------AHL20(2)           --------->AHL25(2)              <---------ARR11(3)                 <------
------>AHL12(3)           <---------AHL25(3)              --------->ARR11(3)              <---------ICU4
------>AHL25(3)           --------->AHL12(1)             --------->YAB1                  --------->AHL25(2)
-------AHL12(1)           <---------AHL12(1)            --------->ICU4                   --------->AHL12(1)
-------AHL25(1)          --------->AHL20(2)            <---------WOX13(2)                <---------AHL12(1)
-->AHL20(2)  <-----------GT1<---------AHL12(2)         --------->WOX13(2)        --------->DOF5.7(1)
------>AHL12(1) ---------->DOF2<---------AHL12(2)     --------->WOX13(1)       ---------->DOF2
->GT1    <---------DAG2  --------->AHL25(3)         ------------>CBF----------->GT1  ----------->GT1
>GT1  <-----------GT1    <---------KAN1      <----------DOF2--------->TOE2(3)  --------->DOF5.7(1)
 
ataaataagttactttttacaaagtcgaataaattatttacccttctgctttaatggcaattatcttaatattgcaaaaaaaaaaagagagaaatattac  23100
           --------->ANAC46
           --------->ANAC58                                                ------>ZmHOX2a(2)       -
       --------->ANAC58                                                  <---------ARR11(2)        -
       --------->ANAC58                      *TSS             <---------ZAT14             <---------KAN1
 --------->MYB52(1)                       ------------------------>ANAC81--------->ARR11(2)      ---
-----GT1   --------->ANAC58              <------ZmHOX2a(1)    --------->ZAT14           <---------GLK1(2)
 
tacaaaacagaagcaagcaagtggaaaacagaccagaagagagaggaagacgaagagagaaacagaacagagtagggatcgatagaccgtggaatctcag  23200
                                                   --------->TOE2(3)
                                                  --------->YAB1
                                                 --------->ICU4
                                          ---------->DOF2
                                    <---------AHL12(2)
                                   <---------AHL20(2)
                                   <---------AHL12(3)
                                   --------->AHL20(2)
                                   <---------AHL12(1)
                                   <---------AHL25(3)
                                   <---------AHL20(3)
                                   <---------AHL25(1)
                                   --------->AHL25(1)
                                   --------->AHL12(3)          <---------ZAT18
                                   --------->AHL20(3)         <---------AtMYB61
        <----------DOF2           --------->AHL25(3)          <---------YAB5         <---------DOF5.7(1)
-------->YAB5   --------->DOF5.7(1)--------->AHL12(1)    --------->YAB1        <---------ANAC58    <
-------->YAB1  --------->DOF5.7(1)--------->AHL20(2)<---------YAB1             <---------ANAC58   <-
------>RVE1(2)---------->DOF2  ------>ZmHOX2a(1) <---------ATHB12            <---------YAB1  -------
 
aatcacaaacactttgcaaaagggttttcaattcctatttatttacaaagaaatcatcaatagtagtggtctctagggttttgcttgctcttcttcgtga  23300
                                          --------->SPL1(2)
                                          --------->SPL7(1)
                                          <---------TOE1(2)
                                         <---------SPL1(1)
                                        <---------SPL7(1)
                                       <---------ANAC58
                                       <---------ANAC58
            --------->ANAC46           <---------ANAC46
            --------->ANAC58          --------------->AtSPL3
        --------->AtLEC2              <---------------AtSPL3
    <-----------GT1               -------------->OsCBT                                        <-----
 <---------DOF5.7(1)              <---------KAN1                                             <------
<---------DAG2                    --------->ALFIN1              <-----------HVH21            <------
<---------DOF5.7(1)             <---------ANAC55(1)     --------->TOE2(3)                    <------
<----------DOF2                 <---------ANAC46        --------->TOE1(3)                   <-------
---------DOF5.7(1)              <---------ANAC58       --------->ZAT6                      <--------
--------DOF5.7(1)--------->MYB46(3)   <---------------AtSPL8--------->GLK1(2)          <---------ALFIN1
---->HVH21  --------->ANAC58    <---------ANAC58 --------->RVE1(2)           <---------DOF5.7(1)  <-
 
cccctttttacctgcaaacaacaacttcaaaattggcgtgtttcgtacggtctatctaaccctaatctgtcacaaaacactcttcttctctcaccccttt  23400
                                                             <---------ANAC46
                                                             <---------ANAC58
                                                         <---------ANAC58
                                                     <<<<<<<<<MYB2
                                                   <------MYB83
                                                   <------MYB46(1)
     --------->KAN1                            <---------ARR14(2)
----DOF5.7(1)                                  <---------ARR11(2)
---DAG2                                        --------->ARR14(2)                   <---------TOE1(2)
----DOF2                   --------->ARR11(2)  --------->GATA12               <----------DOF2
---DOF5.7(1)               <---------ARR11(2)  <---------RVE1(2)        <-----------GT1
--DOF5.7(1)          <----------DOF2           <---------GATA12       <-----------GT1       --------
-DOF5.7(1)      <---------ANAC58           --------->LBD16   <---------ANAC58<---------DOF5.7(1)   -
--------LBD16   <---------ANAC58         <---------LBD16 <---------ANAC58   ------>ZmHOX2a(1)      <
 
ttctgggtttattcaattctcgtgcttttggttctgttttcttctctggggatttggttttcttgagtgagtttttctcctctttcttatgttcttgatt  23500
               <---------YAB1
    <---------AHL20(2)
   --------->AHL20(2)                                                             <---------KAN1
  <---------YAB1--------->YAB1                                                  <------ZmHOX2a(1)
 --------->AHL25(2)                                                             ====================
 --------->AHL20(3)                                                             ====================
 <---------AHL20(3)                     --------->ANAC58  <---------YAB1    <---------ANAC58
<---------ICU4 <---------TOE2(3)        --------->ANAC58 <---------DOF5.7(1)<---------ANAC46   -----
->ATHB12    --------->ICU4<------ZmHOX2a(1)      ---------->DOF2            <---------ANAC58 <------
-------->ICU4--------->YAB1    ------->TEIL--------->RAP2.6(2)          <---------ANAC58     <------
---------YAB1<---------ICU4 <---------KAN1 ----------->RAV1(1)          <---------ANAC58     -------
 
tgattattatatagaattatggtaatggaggatgagcctagagaagccacaataaagccttcttattggctagatgcttgcgaggacatctcttgtgatc  23600
<- Previous    Next ->

AGI:  At1g01040.1   
Description:  DCL1 (DICER-LIKE1); ATP-dependent helicase/ ribonuclease III. Identical to Endoribonuclease Dicer homolog (CAF) [Arabidopsis Thaliana] (GB:Q9SP32;GB:Q9FDY6;GB:Q9MAN0); similar to DCL3 (DICER-LIKE 3), RNA binding / ribonuclease III [Arabidopsis thaliana] (TAIR:AT3G43920.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24342.1); similar to hypothetical protein OsJ_008882 [Oryza sativa (japonica cultivar-group)] (GB:EAZ25399.1); similar to Helicase, C-terminal; Argonaute and Dicer protein, PAZ; Ribonuclease III, bacterial [Medicago truncatula] (GB:ABD32724.1); contains InterPro domain Argonaute and Dicer protein, PAZ (InterPro:IPR
Range:  from: 23146    to: 31227    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version