Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           <---------WOX13(1)                                        --------->ARR11(2)
          <---------WOX13(2)                                         <---------ARR11(2)
          --------->WOX13(2)                         <---------AHL25(1)                            -
      <---------ANAC58                               --------->AHL20(2)                           --
      <---------ANAC58                               --------->AHL20(3)    <----------DOF2      ----
  <---------KAN1                             --------->ARR14(2)      --------->ARR14(2)     ------->GAMYB
------->ANAC58<---------ANAC58               <---------ARR14(2)     --------->GLK1(1)      ---------
--------ANAC55(2)                    <---------AHL20(2)             <---------GLK1(1)     --------->ANAC58
------->ANAC58<---------ANAC58  ---------->ID1       <---------AHL20(3)   <---------DOF5.7(1) ------
------->ANAC55(2) <---------YAB5<---------YAB5       <---------AHL20(2)  ------>ZmHOX2a(1)--------->ANAC58
---ICU4<----------DOF2 ---------->DOF2  --------->AtLEC2      ---------->DOF2  <---------YAB1 ------
tacgcatttgcttaattgctagtcgtcaaagttttgtcattttatgcaaatactaaaaaaatgtagaaagcatttcctctttatttttgggacaaccaag  17815200
                                --------->AHL12(3)                                            ------
                                <---------AHL12(1)                                            ------
                                <---------AHL12(2)                                        ----------
                                <---------AHL25(1)                                        <---------
                                --------->AHL12(1)                                     <-----------GT1
                               <---------AHL12(1)                                   <---------AHL25(2)
                               --------->AHL25(3)                                   <---------AHL25(3)
                               <---------ARR11(3)                                   <---------AHL12(1)
                               --------->AHL12(2)                                   --------->AHL25(2)
                               --------->AHL20(1)                 --------->TOE2(3) --------->AHL25(1)
                               --------->AHL12(1)                 <----------DOF2   --------->AHL12(1)
                               <---------AHL25(2)                --------->YAB5     <---------ICU4
                               --------->AHL25(2)              <---------ARR11(3)   --------->AHL20(2)
                               --------->ARR11(3)              --------->GATA12     <---------AHL20(2)
                               <---------AHL20(1)             <---------CCA1(2)     <---------AHL20(3)
-------->DOF5.7(1)             <---------AHL12(2)           --------->AHL20(2)      --------->AHL20(3)
------->DOF5.7(1)             --------->YAB1  ------>ZmHOX2a(1)--------->ARR11(3)   <---------AHL25(1)
------>DOF2                   --------->AHL12(3)          <----------DOF2          --------->ICU4
>MYB46(3)        --------->ARR11(2)          =======================================================
--->ANAC58       <---------ARR11(2)          <-----------------AGL3       --------->ARR11(3) <------
--->ANAC58    <---------ANAC46--------->AHL12(2)     <-----------GT1 --------->YAB1--------->AHL12(2)
aaaggagcatttcaatagtgtatacatagacaaaaatatttctcatttcctatatttgactctttaaatctttaatagctcttgtaattttttccattca  17815300
                                                                              <---------AHL12(2)  <-
                                                                              --------->ARR11(3)  --
                                                                              <---------ARR11(3)  <-
                                             <---------YAB1                   --------->AHL12(2)  --
                                    <---------AHL12(2)                        --------->AHL20(1)  <-
                                   --------->AHL20(2)                         <---------AHL20(1)  --
              --------->YAB5       --------->YAB1                             --------->AHL20(3)  <-
--->YAB1--------->YAB1           --------->WOX13(2)                           --------->AHL25(2)  <-
--->ATHB12   <---------YAB1      <---------WOX13(2)                           <---------AHL25(2) ---
----->AGL15  --------->ICU4     --------->WOX13(1)        <---------AHL12(2)  <---------AHL20(3) ---
------AGL15  ----------->GT1 <-----------HVH21          --------->AHL20(2)   <---------AHL12(1) <---
======MADS_MADS    ---------->DOF2<---------ATHB51    --------->RVE1(2)      --------->AHL12(1) ----
---ATHB12 --------->ICU4   <------------AtMYB77      <---------KAN1  <---------AHL20(2)--------->YAB1
ttgtaatacagccataatgtttaaaaggaaactgtcaattataaacttatactagaatataaaatatggtattgaattgaatattttcaaaaataaaata  17815400
-->AHL20(3)                                                                                ---------
--AHL12(2)                                                                                --------->KAN1
->AHL12(2)                                                                          <---------ALFIN1
--------AHL20(2)                                                                   ------>MYB83
------->AHL20(3)                                                                   ------>MYB46(1)
--------AHL20(1)                           <---------CCA1(2)                     --------->MYB46(3)
------->AHL20(2)                          --------->RVE1(2)                      --------->AtMYB61
--------AHL20(3)              --------->RVE1(1)                              --------->MYB46(3)
------->AHL25(3)             --------->ARR11(3)                            --------->ARR11(2) ------
--------AHL25(2)             --------->RVE1(2)      ------->GAMYB          <---------ARR14(2) ------
--------AHL25(3)             <---------ARR11(3)     --------->AtMYB61      --------->ARR14(2) ------
------>AHL20(2)              --------->GLK1(2)      --------->TOE2(3)      <---------ARR11(2)<------
------>AHL25(3)       --------->TOE2(3)  <---------CCA1(2)        <---------AtLEC2----------->RAV1(1)
------AHL12(2) --------->AHL20(2)        ------>ZmHOX2a(1)      <-----------GT1 --------->MYB46(3) <
----->AHL12(2)<---------KAN1--------->RVE1(1)      --------->MYB46(3)      --------->RVE1(2)<-------
ttaaatttacgaaaagaataaaaaaacttaaaaatctctctctcctatctctcaaccacaacttatttttcatgtcagtatccaccaacacatatatacg  17815500
                    --------->TOE1(2)                       --------->AHL12(3)
             <---------WOX13(2)                             <---------AHL12(3)
            --------->YAB1                                  ----------->TBP
           <---------YAB1                           <---------O2<---------AHL12(3)
          --------->AHL20(2)                        --------->ANAC46
          <---------AHL20(2)                        --------->ANAC58
       --------->ARR11(3)                           --------->O2----------->TBP
   ---------->DOF2  --------->TOE2(2)               --------->TGA1a
--------->RVE1(2)   --------->TOE2(3)               --------->ANAC58                             <--
>ARR11(2) <---------AHL12(3)                      <---------ALFIN1                             -----
--->ANAC46<---------AHL20(3)                    --------->ANAC58<---------AHL20(2)             -----
--->ANAC58<---------AHL25(1)                    <---------ALFIN1--------->AHL20(2)             *TSS
--->ANAC58--------->AHL25(1)       <---------ARR11(3)     ----------->TBP                     <-----
---LBD16  --------->AHL20(3)       --------->RVE1(2)===========================================bZIP_DOF
---------KAN1--------->WOX13(2)   <---------CCA1(2) <---------TGA1a       --------->YAB1      <-----
----GT1<---------ARR11(3)    --------->RVE1(2)  --------->ANAC58--------->AHL12(3)  <----------DOF2
gcatataaaagattttaataaaaccttggaactatctatatctattcagacacacacgtctatatatatatatacactcatatactactttcactgtatc  17815600
                           --------->TOE2(3)   <-----------GT1                       <---------YAB5
               --------->AHL12(1)          <---------AHL20(3)               --------->ARR11(2)
               <---------AHL25(3)          <---------AHL20(2)               <---------ARR11(2)
-------YAB1    <---------AHL12(1)          --------->AHL20(2)             --------->LBD16
---->KAN1     <---------AHL12(1)          <---------DOF5.7(1) <-----------GT1------>NtERF2  --------
---->YAB5     --------->AHL12(1)      <---------YAB1<---------ARR11(2)    ------>NtERF2     <-------
----YAB1      --------->AHL12(3)     <-----------GT1--------->GLK1(2)     <---------ATERF1(1)
----YAB5     --------->AHL12(2)    <---------KAN1<---------YAB1         <---------LBD16 --------->At4g35610
attcttgttttctctaaatttttcaaaaaacctttagaattttcatttttttacgattccgatgttaactgtttctccggctccagtactcatcggaaac  17815700
                   ------>NtERF2 <---------GATA12
                  <---------RAP2.3(2)                                              <---------At4g35610
                  <---------RAP2.3(3)                                        <---------DOF5.7(1)
                  <---------DEAR3(1)                                        <---------KAN1
                  <---------ATERF1(2)                                   <------NtERF2
                  --------->ATERF1(2)                                  <---------LBD16
                  <---------RAP2.6(2)                                --------->ALFIN1
      <---------ARR11(2) --------->GLK1(1)                         <---------DEAR3(2)
      --------->ARR14(2)--------->GATA12                   <----------DOF2 <---------ARR14(2)
      --------->ARR11(2)<---------GATA12               --------->LBD16<---------MYB46(3)
      <---------ARR14(2)<---------ARR14(2)           <---------LBD16<-----------HVH21  <---------ARR11(3)
     <------ZmHOX2a(1)  --------->ARR14(2)       <---------ANAC58  <---------SPL7(1)   --------->ARR11(3)
 ---------->DOF2  <---------ANAC46       <---------LBD16   <---------DAG2  <---------RVE1(2)
->ARR11(2)       --------->RAP2.6(3) <-----------GT1--------->MYB52(1)<---------DEAR3(1) ------>ZmHOX2a(2)
--ARR11(2)   <---------AtLEC2  <---------TOE2(2) <---------ANAC58  <---------MYB46(3)  <---------RVE1(2)
aactcaaaggatacttacatggcggcagatttcgcagattttacgacggaagacttgccggactttacgacggtcggggatttttccgatgatcttcttg  17815800
                                                                    <---------ARR14(2)             <
                                                                    <---------GLK1(2)             <-
                                                                    --------->ARR11(1)      <-------
                                                                    <---------RVE1(2)   <---------HSFC1(2)
                                                                    --------->ARR14(2)  <---------KAN1
                                                                    <---------GATA12    <----------TaMYB80
                                                                  ----------->ARR10     <---------HSFB2a(1)
                                                         <---------KAN1                 --------->HSFB2a(1)
                                                        --------->GATA12                --------->KAN1
                            <---------MYB46(3)          <---------GATA12                <---------KAN4(1)
                        --------->ATHB12                --------->ARR14(2)              --------->KAN4(1)
                       <---------YAB1                   --------->ARR11(2)              --------->HSFC1(2)
                    <----------DOF2                     <---------ARR14(2)             <---------KAN4(2)
                   <---------DOF5.7(1)                  <---------ARR11(2)   --------->GLK1(2)  <---
                   ------>ZmHOX2a(2)                    <---------RVE1(2)   <---------ARR14(2) <----
                 --------->GATA12                     --------->LBD16--------->ARR14(1)---------->TaMYB80
                 --------->ARR11(3)                 ----------------->AGL1  <---------GLK1(2)<------
                 --------->ARR14(2)                 <-----------------AGL1 --------->HSFB2a(1)------
                 <---------ARR14(2)                 <---------LBD16--------->KAN1 <---------LBD16 --
                 <---------ARR11(3)                 <-----------------AG   --------->GLK1(1)--------
    --------->YAB5<------ZmHOX2a(2)                 <-----------------AGL2 --------->KAN1--------->KAN4(2)
atggaatcgattactacgacgatcttttcattggtttcgatggagacgatgttttgccggatttggagatagattcggagattcttggggaatattccgg  17815900
                                                                         <---------ANAC46   <-------
---------ANAC46                                                          --------->ALFIN1   <-------
--------At4g35610                            --------->At4g35610       <---------ANAC58   <------MYB46(1)
--LBD16                                      <---------At4g35610       <---------ANAC46   <---------MYB46(3)
-----P--------->CCA1(2)         <---------ALFIN1                       <---------ANAC58   <------MYB83
-----MYB52(1)              ----------->GT1   <------NtERF2           <------MYB83        --------->ALFIN1
---HSFB2a(2)             <---------ANAC46 <------NtERF2              <------MYB46(1)     <---------AtMYB61
--->LBD16   <------ZmHOX2a(1)   --------->ZAT6                      <---------AtMYB61    --------->MYB111(2)
------->At4g35610--------->ANAC58        ------>NtERF2           <---------TGA1a         <---------DEAR3(1)
--------->AGL1   --------->ANAC58       --------->ANAC46         <---------O2  --------->ANAC46<----
tagcggaagagatgaggaacaagaaatggagggtaacacttcgacggcatcggagacatcggagagagacgttggtgtgtgtaagcaagagggtggtggt  17816000
--------ANAC46                                                 <---------GLK1(2)
--------AtMYB61                                              --------->ICU4
------->ALFIN1               <---------ANAC46           ----------->GT1
------MYB46(3)               <---------ANAC58          --------->DAG2
---MYB46(3)                  <---------ANAC58 --------->DOF5.7(1)
->ALFIN1<---------MYB46(3)  --------->SPL7(1)--------->DOF5.7(1)      <---------ARR11(2)
-----DEAR3(1)               <-------TEIL --------->ANAC58    <---------YAB1               ----------
---->ALFIN1                 --------->ABI4(2)--------->DAG2  --------->DOF5.7(1)          <---------TOE2(3)
--AtMYB61             --------->MYB52(1) --------->ANAC58    <---------YAB5  --------->YAB1
--DEAR3(1)<----------DOF2  --------->ALFIN1 ---------->DOF2---------->DOF2--------->At4g35610      -
-----AtMYB61    <----------ID1<-----------HVH21       ---------->DOF2--------->KAN1 <---------ARR11(3)
ggtggtgacggtggttttagggacaaaacggtgcgtcgaggcaaacgtaaagggaagaaaagtaaagattgtttatccgatgagaacgatattaagaaaa  17816100
<- Previous    Next ->

AGI:  At5g44190.1   
Description:  GLK2 (GOLDEN2-LIKE 2); DNA binding / transcription factor. similar to GPRI1 (GOLDEN2-LIKE 1), transcription factor [Arabidopsis thaliana] (TAIR:AT2G20570.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69795.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 17815596    to: 17818051    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.