Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               <---------ARR11(2)
              --------->ATERF1(1)  ------>ZmHOX2a(2)
             <---------ATERF1(1) --------->GATA12
           <------NtERF2      --------->LBD16
        ------->MYC3         <---------ANAC46
        <-------MYC3<---------MYB52(1)                                                          ----
       --------->ANAC46    --------->LBD16                                                --------->WOX13(1)
       --------->ANAC58   --------->DEAR3(1)                                             --------->MYB46(3)
       --------->ANAC58   --------->ANAC46             <-------GAMYB                 --------->HSFC1(2)
       --------->O2 <---------ARR11(2)              <---------RAP2.6(3)              <---------HSFC1(2)
     <---------ALFIN1   ==================HOX2a_HOX2a<------NtERF2                   <---------HSFB2a(1)
    --------->MYB46(3)  ------>ZmHOX2a(1)          --------->DEAR3(1)               --------->ANAC58
  --------->ANAC46  --------->ARR14(2) ----------->RAV1(1)                          --------->ANAC58
-------DOF5.7(1)    --------->ARR11(2)--------->ANAC46<---------MYB46(3)<-----------RAV1(1)     <---
---ALFIN1 <-----------HVH21------>NtERF2      --------->At4g35610    --------->ATHB12--------->HSFB2a(1)
 
tcttcccaccacgcgtcgtctccgttcctccgccgtgatccacaacatcagaagccgtcgttgttgttatctccattggtgctggagaagcatccatcag  17756700
                                         --------->ARR11(2)
                                         <---------AGP1
                                         <---------ARR11(3)
                                         --------->ARR14(2)
                                         --------->GATA12
                                  <---------ANAC58
                                  <---------ANAC58
                                 <---------At4g35610
                              <------MYB83
                              <------MYB46(1)--------->At4g35610
                             <---------AtMYB61
                             <---------DEAR3(1)
                             <---------MYB46(3)
                            <---------MYB52(1)     ---------->DOF2
                           <-------GAMYB <---------ARR14(2)
         <---------KAN1   <---------ANAC58  ----------->HVH21
        ------->TEIL      <---------ANAC46 ------>ZmHOX2a(2)
        <---------GATA12  <---------ANAC58<---------At4g35610     --------->RVE1(2)
     --------->ANAC58  --------->GLK1(2) <---------GATA12 <---------ANAC58
     --------->ANAC58 --------->ARR14(2) <---------ARR11(2) ----------->GT1
     --------->ANAC46 <---------ARR14(2) <---------RVE1(2)<---------ANAC46             <---------KAN1
----->GATA12          <---------GLK1(2)<---------MYB46(3) <---------ANAC58    <-----------HVH21    -
------GATA12         --------->KAN1<---------AtMYB61      ----------->GT1----------->HVH21    ------
 
atttatcgacgcatctaagagtgaagattccgttggtgctggtggatctgatgcgaaagtatcgtgtaaaatcccttcgaccgtcatcgaatttgaactg  17756800
                        ------->GAMYB
                        --------->At1g77200
                        --------->ANAC46
                        ----------->HVH21         <-----------RAV1(1)
                       <------------AtMYB77    <---------ARR11(2)
                       --------->MYB46(3)      --------->ARR11(2)
                     --------->ARR11(2)        --------->ARR14(2)
                     --------->ARR14(2)        <---------ARR14(2)
                     <---------ARR14(2)       <------NtERF2
                     --------->MYB52(1)      --------->LBD16
                    ----------->HVH21<---------AGP1
                   --------->At5g28300<------ZmHOX2a(2)
                  --------->RAP2.3(2)--------->ARR11(3)
                  --------->RAP2.6(2)<---------RVE1(2)
                --------->LBD16      <---------GATA12
           <---------ANAC58          --------->GATA12                                             --
        <---------MYB52(1)           <---------ARR11(3)                                           <-
     <---------MYB52(1)--------->DEAR3(2)   --------->ANAC46--------->ARR11(3)                ------
    <-----------HVH21<---------ARR11(2)------>ZmHOX2a(2)    <---------ARR11(3)                ------
-------->KAN1   ------>NtERF2       <---------CCA1(2)<---------MYB46(3)               --------->At4g35610
----->GT1  <---------ANAC58<---------ALFIN1<---------LBD16<---------AtMYB61>>>>>>>>>TBF1 --------->At4g35610
 
tataatccgtcgtttcttccgccgtaaccgacacttgttagatctcgccggaactgttgttgaggtcttatagacgaagaagaagtagaagcagaagaga  17756900
                                                     --------->TGA2(2)
                                                    <-----------HVH21
                    --------->HSFC1(1)             <<<<<<<<<<HY5
                    --------->HSFB2a(2)            --------->bZIP60(2)
                    <---------HSFB2a(2)            --------->bZIP60(1)                           ===
          --------->CCA1(2)                        <---------bZIP60(1)                           ---
          <------ZmHOX2a(2)                        --------->ANAC46                           ------
         --------->ARR11(2)                        --------->O2                             <-------
         <---------ARR14(2)                        <---------O2                             <-------
         <---------RVE1(2)                         <---------TGA2(1)                       ---------
         --------->ARR14(2)                    --------->DEAR3(2)                      --------->MYB52(2)
         <---------ARR11(2)                ----------->HVH21                           <---------MYB46(3)
         --------->AGP1                  --------->At4g35610                       <---------ANAC46
         <---------GATA12                <---------At4g35610 --------->LBD16       <---------ANAC58
         --------->GATA12                ----------->RAV1(2)--------->HSFB2a(2)    <---------ANAC58
       ----------->ARR10              <---------KAN1<-----------TGA1            --------->ARR14(2)
--------->HVH21 <---------KAN1       <-----------HVH21      <---------HSFB2a(2) <---------ARR11(2)
---------ID1 --------->LBD16      --------->ANAC58 --------->TGA2(1)            --------->ARR11(2) <
--->KAN1--------->KAN1   <---------KAN1<---------ALFIN1    <---------LBD16      <---------ARR14(2)<-
--->CCA1(2)------>ZmHOX2a(2)      --------->ANAC58<-----------STF1    --------->YAB5 <---------MYB52(1)
 
tgcgacgagatagatccgagtttctcgaatttgaagaacgcatcacctgaaacgacgtcatttctggagaagatgatgaacaagttccgtttgtttcgtc  17757000
               <------ZmHOX2a(2)
              --------->GATA12
              <---------ARR14(2)
              --------->ARR11(2)
        <---------GLK1(2)
        <---------ARR11(2)
       <------NtERF2    --------->YAB5
      --------->LBD16  <---------YAB5
     --------->LBD16   <---------KAN1
    <---------LBD16   --------->RVE1(2)
======================HOX2a_HOX2a
--->ZmHOX2a(1)<---------ARR11(2)
---->ID1--------->ARR14(2)
--ANAC58<---------ARR14(2)                                                        <---------DOF5.7(1)
--ANAC58--------->ARR11(2)                  ------>NtERF2          --------->At4g35610
------>AtSPL8 --------->ARR14(2)            --------->LBD16   <---------HSFB2a(2)<---------DOF5.7(1)
----------DOF2<---------GATA12     <----------DOF2        <----------DOF2        <---------DAG2
--------DOF5.7(1)     --------->GLK1(2)    --------->ANAC46   --------->HSFB2a(2)<----------DOF2   *TSS
 
ctctttcgccggaatcggatcagagaatcactctgtttctttgactccgccaaatgttgaactttacagaagcagagattagggctttttgtgtcgaatt  17757100
                                                                                                 ---
                                                                                               -----
                                                                                       <-------PIF5
                                                                                       <-------PIF4
                                                                                       ------->MYC2
                                          <---------WOX13(1)                           <-------MYC3
                                         <---------WOX13(2)                            ------->PIF4
                                       <---------AHL20(3)                              <-------MYC2
                                       --------->AHL20(1)                              ------->MYC4
                                       <---------AHL20(2)                              <-------MYC4
                                       --------->AHL20(2)                              ------->MYC3
                                       <---------AHL20(1)                              ------->PIF5
                                       <---------AHL25(1)                             --------->bZIP60(2)
                                       --------->AHL25(1)                             ==============
                                       <---------AHL25(2)                             --------->ANAC58
                                       <---------AHL25(3)                             ==============
                       --------->KAN1<---------WOX13(2)                               ==============
                      <---------AHL12(1) <------------CBF                             <---------ANAC55(2)
                      <---------AHL20(2) <---------AHL12(2)                    <-----------RAV1(1)
                      <---------AHL25(1) --------->WOX13(2)                  <---------KAN1    -----
                      --------->AHL12(1)<---------AHL25(3)               --------->ANAC58      <----
                     --------->AHL12(2)--------->AHL25(3)                --------->ANAC58     ------
                     <---------AHL12(2)<---------AHL12(1)               ------->PIF5  --------->ANAC58
                ----------->GT1      --------->WOX13(2)                 ------->MYC2  --------->O2
            <----------DOF2        <---------YAB1       <----------DOF2 <-------MYC2  --------->ANAC55(2)
         --------->ARR11(3)      --------->YAB1=================================================bZIP_DOF
         <---------ARR11(3)      ----------->GT1     <-----------GT1    <-------MYC3  <---------O2
      --------->HSFB2a(2)      <------------CBF<----------DOF2          ------->MYC3  <---------TGA1a
   <----------DOF2  --------->AHL12(2) --------->AHL12(1)     --------->AHL20(2)      --------->TGA1a
 <---------HSFB2a(1)--------->WOX13(2)--------->AHL25(3)<---------DAG2  <-------PIF5<------------OsbHLH66
--------->GLK1(2)   <---------WOX13(2)--------->AHL12(2)========================================bZIP_DOF
 
gagaacctttgagaacttttggtaatttatcccaaattgtaattaattgacttttattacttttttaaaataccacgcgcatatgtggcacgtgagtttt  17757200
                                                                                         --------->ALFIN1
                        <---------------AGL15                                           <-------MYC3
                       <-----------------AGL2                                           ------->MYC3
                       <-----------------AG                                             <-------MYC2
         -------->P   --------->At4g35610                          <---------ARR11(3)   ------->PIF5
------>AHL12(2)       <---------At4g35610   --------->DAG2         <---------GLK1(2)    <-------PIF5
---->AHL25(3)      --------->DOF5.7(1)      <---------TOE2(3)      <---------RVE1(2)    ------->MYC2
==================MYC_MYB <---------RVE1(2) <---------TOE1(3)      --------->GATA12    <---------ANAC58
=======================bZIP_DOF     <---------WOX13(2)             --------->ARR11(3)  <---------ANAC58
=======================bZIP_DOF----------->GT1      --------->RVE1(2)        <----------DOF2       <
---->AHL25(1)     --------->DOF5.7(1)    <---------RVE1(2)       ----------->ARR10     <---------ANAC46
-----AHL20(2)    ---------->DOF2    --------->WOX13(2)--------->YAB1         =======================
--->AHL25(3)---------->DOF2   --------->MYB59----------->GT1  <---------RVE1(2)        --------->ALFIN1
 
aatttttagacttaccaaagaaaagagctgattttggtaaattggataaggttaaaatcaaaatggataagattttctaacttttggagcgcgtgggaag  17757300
                                                     --------->TOE2(3)
                                                    --------->YAB5
                                                   <---------YAB1
                                                   <------ZmHOX2a(2)
                                                  <---------ARR11(3)
                                                  --------->ARR11(3)
                                                  --------->RVE1(2)
                                         <---------ICU4
                                         --------->ATHB51
                                         <--------HAHB4
    --------->O2                         --------->AHL25(1)
    <---------ANAC58                     <---------AHL25(3)
    <---------TGA1a                      -------->ATHB1
    <---------O2                         <---------AHL25(1)
    <---------ANAC55(2)                  --------->AHL20(2)                       <---------ANAC46
    <---------ANAC58                     <---------AHL12(1)                       <---------ANAC58
    <---------ANAC46                     --------->AHL12(1)                       <---------ANAC55(2)
    --------->ANAC55(2)                  <---------AHL20(2)                    <---------YAB1    ---
    --------->TGA1a                     --------->ICU4<---------YAB1         --------->YAB1     <---
  <---------ANAC46                      <---------ATHB51          <-----------GT1 <---------ANAC58
<-----------HVH21                       <---------ATHB12       --------->YAB1<--------HAHB4     <---
-----------RAV1(1)                      --------->AHL25(3)    <---------YAB1 <---------ICU4 --------
==============bZIP_DOF                --------->WOX13(1) <---------TOE2(3)  <---------YAB1  <-------
 
ttttgtcgcgtgtcatcaaactgtagttgtcaaacttgcatcaattatttcaagatcattaatgtattataacttgactattattacttgaatttagtta  17757400
                 <---------AHL20(2)
          <---------bZIP60(1)
         <---------TOE2(3)
         ----------->STF1
       ----------->TGA1
    <---------AHL20(2)
    <---------AHL25(3)
   <---------AHL25(2)
   <---------AHL20(3)
   --------->AHL25(1)
   <---------AHL25(1)                                          <---------AHL12(2)
   --------->AHL20(3)                                          --------->AHL12(2)
   <---------AHL20(2)                                          <---------AHL12(3)
   --------->AHL20(1)                                          --------->AHL12(3)
   <---------AHL20(1)                                         --------->AHL25(2)
   --------->AHL20(2)                                         <---------AHL25(2)              <-----
   --------->AHL25(3)          <-------GAMYB                 <---------RVE1(1)              xxxxxxxx
  --------->AHL12(2)          --------->MYB111(1)            <---------CCA1(1)     <---------TOE1(3)
 --------->WOX13(2)           --------->MYB55(2)            --------->ARR11(3)     <---------YAB1
 <---------WOX13(2)<-----------GT1                          <---------AHL20(1)     <---------TOE2(3)
-------->GT1<---------MYB52(1)<---------MYB46(3)            <---------RVE1(2)  <---------AHL20(3)
------TOE1(3)  <---------WOX13(2)             <---------KAN1<---------ARR11(3) --------->AHL20(3)
------TOE2(3)  <---------YAB1 --------->MYB111(2) <---------ZAT14              <---------AHL20(2)
->WOX13(2)--------->bZIP60(1) --------->MYB52(2) <-----------GT1               --------->AHL20(2)  -
--WOX13(2)----------->GT1    <--------P     xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<---------YAB1<-----
 
aggtaatttaatgacgttattttaactcgatggtagttgtttttagagaatattacactgtaagatattttttaaaaaacatttttatggttagacactt  17757500
                                                                                          <---------DOF5.7(1)
                                                                                --------->KAN1
                                                            <-----------GT1     <---------AHL20(2)
      --------->DAG2                                       <-----------GT1      <---------AHL25(3)
     ---------->DOF2                               <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3) <----------DOF2
   --------->ARR11(3)                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)  <---------DOF5.7(1)
<---------TOE2(3)                                --------->ANAC55(2)      <---------DOF5.7(1)
----DAG2                xxxxxxxxxxxxxxxx>smallRNA(s)    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <----
xxxxxxxxxxxxxxx>smallRNA(si3)             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->AHL25(3)
--------->DOF2         --------->ATHB12  <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  --------->AHL12(2)  <-
-----DOF2     <---------YAB1   <---------YAB5    <---------ANAC55(2)  ------>ZmHOX2a(1) <---------DOF5.7(1)
 
tttaaagataaagcattttgaatagatgatttgactcatttatcgtctaatcacatatcgttttatctctctccttctcttatttattctctctttttct  17757600
<- Previous    Next ->

AGI:  At5g44080.1   
Description:  bZIP transcription factor family protein. similar to GBF4 (G-box binding factor 4), transcription factor [Arabidopsis thaliana] (TAIR:AT1G03970.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43627.1); contains InterPro domain bZIP transcription factor, bZIP-1; (InterPro:IPR011616); contains InterPro domain Basic-leucine zipper (bZIP) transcription factor; (InterPro:IPR004827)
Range:  from: 17755879    to: 17757100    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.