Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                      <---------DEAR3(1)
                                                                     <---------LBD16
                                                                 ------>ZmHOX2a(2)
                                                                <---------GLK1(1)
                                                                --------->GLK1(1)
                                                                <---------KAN1
                                                                <------ZmHOX2a(2)
                                                               <-----------ARR10
                                                               <---------GATA12
                                                               --------->GATA12
                                                               <---------ARR11(3)
                                                               --------->ARR11(2)                  -
                                                               --------->ARR11(3)                  -
               <---------DOF5.7(1)                             <---------ARR11(2)               <---
               <----------DOF2                                 <---------AGP1                   <---
              <---------DOF5.7(1)                              --------->ARR14(2)               ----
            ------>NtERF2                                     <---------CCA1(2)                <----
           --------->RAP2.6(2)                              --------->TOE1(1)                  <----
          --------->MYB46(3)           --------->SPL7(1)    --------->TOE2(1)                 ------
          --------->ATERF1(1)        <---------SPL7(1)     =============HOX2a_HOX2a           <-----
         <---------At4g35610        <---------ANAC58       <---------LBD16                 <--------
         ------>NtERF2              <---------ANAC58       ------>ZmHOX2a(1)   <---------DOF5.7(1)--
   <---------ANAC58       <---------ICU4         --------------->AtSPL3       <---------DAG2  <-----
   <---------ANAC58     --------->GLK1(2)        <---------------AtSPL3       <---------DOF5.7(1) --
<----------DOF2<---------DAG2    --------->ANAC58--------------->AtSPL8--------->LBD16 --------->LBD16
---------DOF5.7(1) --------->ANAC46 --------->RAP2.6(2)    --------->LBD16    <----------DOF2<------
---------DAG2 <---------DAG2     --------->ANAC58<---------------AtSPL8------>NtERF2  <---------LBD16
--------GT1<---------ALFIN1  <------ZmHOX2a(1)   <---------YAB5<---------ARR14(2)    <---------LBD16
 
cacctttcttgcagccacctttacgaaaatcaggacaagccgtaccagagtaatggtacttcctcggatctctccggcgagctttttctccgggatgagc  14393000
   --------->KAN1
   <---------ALFIN1
-------->ANAC58                                                                                   --
-------->ANAC58          --------->ANAC46                         --------->ARR11(2)              <-
------SPL7(1)            ------>NtERF2                            <---------ARR14(2)              --
------ZAT14              --------->LBD16                          <---------ARR11(2)              --
----->ZAT18            <---------LBD16                            --------->ARR14(2)              <-
-----ANAC58        --------->YAB5                               --------->LBD16                   --
-----ANAC58  --------->WOX13(1)                                --------->ANAC46              <------MYB83
--------->AtSPL3<---------ICU4                                 --------->ANAC58              <------MYB46(1)
----------AtSPL8--------->YAB1                                 <---------ANAC55(2)           -------
-KAN1    <-----------HVH21------>NtERF2  ----------->RAV1(2)   --------->ANAC58     <---------YAB5<-
------->SPL1(2)<---------ATHB12     <---------ALFIN1       --------->KAN1          --------->ANAC58
----------AtSPL3--------->YAB5 <-------PIF5    <----------DOF2 --------->ANAC55(1) --------->ANAC58
------->SPL7(1)--------->ICU4  ------->PIF5------>ZmHOX2a(1)  <---------LBD16<---------KAN1 <-------
------------SPL14 <---------YAB1   --------->ZAT18     ----------->GT1 <-----------HVH21 --------->ATHB12
 
gtacggacactccgtccaatcatgactccggccacgagcacacctcctgactttgaaatcgtacatacggaaatggtcgcatgagtaagcatcgattggt  14393100
              --------->CCA1(2)
             <---------ARR11(2)
             --------->ARR11(2)
             <---------ARR14(2)
             --------->ARR14(2)
             --------->ARR11(3)
             --------->ARR11(1)
             <---------RVE1(2)
             <---------GATA12            <---------MYB52(1)
             --------->AGP1             <-------GAMYB
             <---------AGP1            --------->MYB52(2)
     --------->ANAC58                  <---------MYB46(3)
     --------->ANAC58          --------->ARR14(2)
    --------->SPL7(1)          --------->GATA12 --------->At5g28300
    <---------ARR11(2)         <---------ARR11(2)                    >>>>>>>>>E2Fc
  --------->LBD16          <---------LBD16    --------->ANAC46      ------>NtERF2
<---------LBD16<---------LBD16 <---------ARR14(2)                   --------->LBD16
------->GATA12<------ZmHOX2a(2)--------->ARR11(2)                  --------->ANAC46
--------GATA12--------->ARR14(1)      <-------TEIL                 --------->ANAC58
------->GLK1(2)------>ZmHOX2a(2) ------>ZmHOX2a(2)    --------->MYB52(1)
------->ARR14(2)       --------->YAB5<---------MYB52(1)            --------->ANAC58 --------->ANAC58
--------ARR11(2)    <---------KAN1  <---------MYB52(1)<-----------GT1>>>>>>>>>E2Fd  --------->ANAC58
------->ARR11(2) --------->LBD16 <---------LBD16<------NtERF2     <---------LBD16 --------->YAB1
---->GT1     --------->GATA12  <---------GATA12----------->GT1 -------->P       --------->ANAC58
--------ARR14(2)<---------ANAC46<------ZmHOX2a(2)   <---------MYB52(2) ---------->DOF2     ---------
--MYB46(3) ----------->ARR10 --------->LBD16 --------->RAP2.6(3) ------->GAMYB  --------->ANAC58
 
gaatccggacccaatagatccgggtatgactccggatccggttcgttagacggcaaataacgctgcaaccccgccaaagcttcaagcatgctacaatctg  14393200
                                                 --------->ANAC46
                                                --------->MYB46(3)
                                    --------->ARR11(3)                                            <-
          --------->LBD16           <---------ARR11(3)                             ------>ZmHOX2a(1)
   <---------ICU4                  <---------At4g35610                             =================
   --------->YAB1        ------>NtERF2          --------->ATERF1(2)               --------->TOE1(2)-
  <---------YAB5        ----------->HVH21      --------->DEAR3(2)           <---------KAN1        <-
>GLK1(2)<---------LBD16 --------->DEAR3(1)    --------->MYB52(1)  <<<<<<<<<<<<<<<<<LFY   <---------KAN1
 
gactattcatcaccggagaaaaaaactccgacgttgtaagctcttcaagtaccggccatggaggtatttcaacagtgggataagtcctgcgagtttctcc  14393300
            --------->YAB1
         --------->TOE2(3)
         <----------DOF2      <---------AHL12(1)          <---------DOF5.7(1)
 <---------YAB5               --------->AHL20(2)         <----------DOF2                        ----
--------ATHB12                <---------AHL20(2)      <---------ARR11(3)                     -------
=====HOX2a_HOX2a              ---------->DOF2         --------->ARR11(3)      *TSS          --------
-------->YAB1       --------->LBD16               --------->DOF5.7(1)       <---------ANAC46--------
-----ZmHOX2a(2)   <---------LBD16             --------->ANAC46         <-----------RAV1(1) <--------
 
gatcatcatcttctttaatactccggtgaacaataaatcacattagtcgacgaaagagttctttttttttgtttgtgttgtttgtttgtaatacaccggc  14393400
                                             <---------AHL12(2)
                                             --------->WOX13(2)
                                             --------->AHL12(2)
                                           --------->AHL25(2)
                                           --------->AHL25(3)
                                           <---------AHL25(1)
                                           <---------AHL25(3)
                                           <---------AHL20(2)
                                           --------->AHL12(3)
                                           <---------AHL12(3)
                                           --------->AHL25(1)
                                           --------->AHL12(1)
                                           --------->AHL20(2)
                                          <---------AHL12(3)
                                          --------->AHL12(3)
                                          --------->AHL25(1)
                                          <---------AHL20(2)
                                          <---------AHL25(1)
                                          <---------AHL12(1)
                                          --------->AHL25(3)
                                          <---------AHL25(2)
                                          --------->AHL12(1)
                                          --------->AHL25(2)
                                         <---------AHL25(2)
                                  ----------->GT1         ---------->DOF2
                                  <------MYB46(1)     ----------->GT1
                                  <------MYB83   --------->WOX13(2)
                                 --------->MYB59<-----------GT1--------->CCA1(2)
                                 <---------AtMYB61   <---------YAB1
                               <---------ANAC46--------->AHL20(2)
                             <---------MYB46(3)<---------AHL20(2)   <---------YAB1
                          ------->GAMYB  <---------AHL20(3)    --------->KAN1
                        <---------At5g28300<---------AHL12(1) --------->ARR11(3)                 <--
------>DOF2            --------->MYB52(1)--------->AHL25(2)   <---------ARR11(3)              <-----
-->LBD16            --------->ANAC46     --------->AHL12(2)   --------->AHL20(1)              ------
->DREB2C(2)         <---------ANAC55(2)  --------->AHL12(3)   <---------RVE1(2)      --------->YAB1
->DEAR3(1)          --------->ANAC55(2)  --------->AHL20(3)<---------TOE2(3)         ----------->GT1
-LBD16              --------->ANAC55(1)<---------YAB1<---------TOE2(3)    <------ZmHOX2a(1)---------
 
aaagctacttatgtagttgaaacacttaaccgtggtttggttaaaattatttaactatggttaaagatattagcataggactaggttatcgtaacaaagc  14393500
                                                              <---------ANAC55(2)
                                                              <---------ANAC58
                                                              --------->ANAC55(2)
                  --------->At4g35610                --------->WRKY38(1)
           ----------->HVH21                      <---------ANAC58
          <-------MYC3                            <---------ANAC58
     --------->ANAC58                            ------->TEIL <---------ANAC58
     --------->ANAC58--------->At4g35610         <-------TEIL <---------ANAC46
   --------->CCA1(2) --------->ZAT2            <---------SPL7(1)
  <---------RVE1(2) <---------MYB46(3)    --------->CCA1(2)<---------MYB52(1)   --------->YAB1
---------HVH21    <---------At4g35610--------->ANAC46--------->WRKY12     --------->YAB5
----ZAT2  ------->MYC3          --------->RVE1(2)--------->SPL7(1)   --------->ALFIN1        <------
--->ZAT2 ----------->GT1        --------->ARR11(2)<---------ANAC46 <---------ANAC46<---------ICU4
->DOF2   <---------KAN1        --------->KAN1--------------->AtSPL3<---------bZIP60(2)   <----------DOF2
 
tgtgagataagcatgtgaaacagcggctggagacttatccacgagatagacgtacgtggaccgtttcgtgatgtggacgtttatcaaaatgactttgacg  14393600
                                                <-------TEIL<-------GAMYB
                                               --------->ARR14(1)
            ------>MYB83                      <---------ARR11(2)
            ------>MYB46(1)                   <---------ARR14(2)
            --------->MYB52(1)                --------->ARR11(1)                     <----------ID1
          <---------MYB59                     --------->ARR14(2)                  --------->DOF5.7(1)
       --------->ARR11(2)               --------->KAN1     <------MYB46(1)      ---------->DOF2
       <---------ARR11(2)            <------ZmHOX2a(1)     <---------DEAR3(2)  --------->LBD16
       <-----------GT1          <----------DOF2--------->CCA1(2)        <---------RVE1(2)
       --------->MYB52(1) ----------->GT1     <---------RVE1(2)         --------->GATA12           -
   <---------TOE2(3)     <---------TOE1(3)    --------->ARR11(2)      ----------->ARR10          ---
  ---------->DOF2     <---------SPL7(1) --------->ATHB12   <------MYB83 <---------GLK1(2)       <---
---TOE2(3)------->GAMYB  --------->DAG2<---------YAB1     <---------DREB2C(2) --------->ANAC46------
 
aagtttaaagtaaccgaactgtgagcgtaaggttactttaggattattagatacgttgaagtcggtcgaagtttagattctccgaaagacgacaaaatag  14393700
                                                                         <---------AtLEC2
                                                                         <---------ANAC46
                                                                         <---------ANAC58
                                                                <---------AHL12(1)
                                                                --------->AHL12(1)
                                                                --------->KAN1
                                                                <---------ICU4
                                                                <---------AHL20(2)
                                                               <---------YAB5
                                                               <---------YAB1
                                                               --------->ICU4<---------CCA1(2)
                                                               <---------ATHB51
                                                              --------->AHL12(2)
                     --------->WOX13(2)                       <---------WOX13(2)
                     <---------WOX13(2)                       --------->WOX13(2)
                   --------->AHL25(3)                       --------->AHL25(1)
                   <---------AHL25(1)            --------->WOX13(2)      <---------ANAC58
                   --------->AHL25(1)            <---------WOX13(2) <---------MYB46(3)
                   --------->AHL20(2)        <---------ANAC55(2)-------->HAHB4
                   <---------AHL20(2)        --------->ANAC55(2)<---------AHL25(3)
-------->RVE1(2) --------->TOE2(3)         <-----------GT1  --------->AHL20(2)
------>KAN1      <---------WOX13(2)   --------->TOE2(3)     <---------AHL20(2)                  ----
------RVE1(2)    --------->WOX13(2)   <---------DAG2        <---------AHL25(1)------->TEIL     <----
----->GT1      <-------TEIL  <---------ARR11(2)<---------AHL20(2)  <---------YAB5     --------->AHL12(2)
 
ataatccacagttttagtttcattaattagtctatccattgccttattacttaatttgtttgtttaattattcgttgcatgtatctcttattttttatat  14393800
             <---------AHL25(3)
            --------->AHL25(1)
            <---------AHL20(2)
            --------->AHL20(2)
            <---------AHL25(3)
            --------->AHL20(1)
            <---------AHL12(1)
            --------->AHL12(1)
            <---------AHL20(1)
            <---------AHL25(2)
            --------->AHL20(3)
            --------->AHL25(3)
            --------->AHL25(2)
            <---------AHL20(3)
            <---------AHL25(1)
           --------->AHL12(2)
           <---------AHL12(2)
          --------->AHL12(2)
         <---------AHL20(2)
         --------->AHL25(1)
         <--------ATHB1
         --------->AHL20(3)
         <---------AHL25(1)
         --------->AHL25(2)
         --------->ATHB51
         <---------ICU4
         <---------AHL25(3)
         <---------AHL25(2)
         <---------AHL20(3)
         --------->AHL20(2)                          <---------AHL25(1)
         --------->AHL12(1)                       <---------AHL20(2)
        <---------YAB1                           --------->AHL20(2)
        --------->AHL25(3)                     <---------AHL25(2)
        --------->ICU4                         --------->AHL25(2)
       <---------AHL20(3)                      <---------AHL20(3)
       --------->AHL25(2)                      --------->AHL20(3)
       --------->AHL20(3)                    --------->AHL25(3)
       --------->AHL12(2)                    --------->AHL25(2)
       <---------AHL25(2)                    --------->AHL25(1)
       --------->AHL12(3)                    <---------AHL20(3)
      --------->YAB1 --------->AHL12(2)      --------->AHL20(3)
     <---------AHL20(2)                      <---------YAB1
     <---------YAB1  <---------AHL12(2)      --------->AHL12(3)
    --------->AHL25(3)                       <---------AHL20(2)
    --------->AHL20(3)                      --------->AHL20(3)
    --------->AHL20(2)                      --------->AHL12(2)
    <---------AHL20(3)             --------->ATHB12  <---------AHL12(3)
    --------->AHL25(1)            <---------YAB1<---------YAB1
    <---------AHL25(2)         --------->ICU4<---------AHL12(3)
    --------->AHL25(2) --------->ATHB51     <---------AHL25(2)                                    --
    --------->AHL20(1)<---------YAB1        --------->AHL25(2)                                    --
    <---------AHL20(1)<---------YAB5<---------RVE1(2)--------->AHL12(3)    <---------YAB5        ---
----->YAB5<---------AHL12(2)<---------YAB5  <---------AHL12(2)  <---------TOE2(3)          ---------
-----YAB1<---------AHL12(1) <---------YAB1  <---------AHL20(3)<---------KAN1               ---------
 
gattcaatataataatttattgtttattattgtcattttgatttgaatattattatatatatcgaatgaggttattgtatcatttatctagcaataaaaa  14393900
<- Previous    Next ->

AGI:  At4g29190.1   
Description:  zinc finger (CCCH-type) family protein. similar to zinc finger (CCCH-type) family protein [Arabidopsis thaliana] (TAIR:AT2G19810.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN81808.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571)
Range:  from: 14391944    to: 14393379    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.