Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               --------->ARR11(2)
            <---------TOE1(3)
            <---------TOE2(3)
  --------->At4g35610
  <---------At4g35610
  <------NtERF2--------->ARR14(2)
  <-------GAMYB<---------ARR14(2)
 ------>NtERF2 <---------GATA12
 <---------ERF1<---------RVE1(2)
 <---------RAP2.3(1)
 <---------MYB46(3)                                                                      --------->YAB5
<---------ANAC46--------->GLK1(1)   --------->ANAC55(2)                        --------->AHL20(2)
<---------ATERF1(2)                 --------->ANAC46                           <---------AHL25(2)
<---------DEAR3(1)                  --------->ANAC58                           <---------AHL20(3)
<---------RRTF1(2)                  --------->ANAC58                    ----------->GT1 <---------KAN1
--------->ATERF1(2)          <----------DOF2                      --------->YAB1 --------->YAB1
<---------DREB2C(2)     --------->KAN1                           <---------YAB5--------->AHL25(2)
<---------RAP2.3(3)    --------->ARR14(2)                      <---------ICU4  --------->AHL20(1)
<---------RAP2.3(2)    <---------ARR14(2)                      --------->YAB1  <---------AHL12(3)
<---------RRTF1(3)     --------->ARR11(3)                     --------->ICU4  --------->YAB1 -------
<---------RAP2.6(2)    <---------ARR11(3)                    --------->AHL20(3)--------->AHL20(3)
---------LBD16<------ZmHOX2a(1)    <---------TOE1(2)         <---------AHL20(3)<---------AHL12(2)
-------->RAP2.6(3)    <---------CCA1(2)                     --------->YAB1    --------->AHL12(2)
 
ttggcggctgtttttaaggatttgcatatattctttcccacgtattgaattctataaatgacataataatcaaacttgtaaaaataatagaatgaatagt  9414000
                                                                                                 ---
                                                                                              ------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                            <-------
                                                                                          <------MYB46(1)
                                --------->ARR11(2)                                        <------MYB83
                                <---------ARR14(2)                                      <--------P
                                <---------ARR11(2)                                    --------->MYB55(2)
                      <-------GAMYB                                                   --------->ATHB12
                     <-----------RAV1(1)                                              <---------MYB46(3)
                 <---------GLK1(1)                              <---------YAB1     --------->TOE2(3)
       --------->HSFB2a(2)      --------->ARR14(2)        ------->TEIL      <----------DOF2 --------
---->GT1  --------->KAN1<---------REM1(1)              <---------YAB1 <------ZmHOX2a(1)<-------GAMYB
 
ttatagtcttccaaaattcgatttctgttgtagtggaatcgcagacattttctaacttatgaatgttgttataggacttctttaaaccttggttggatat  9414100
                                                                                                 ---
                                                                                                 <--
                                                                                                <---
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              <-----
     <---------AHL12(2)                                --------->MYB46(3)                     ------
     --------->AHL12(3)                               <<<<<<<<<<<<<<<<<LFY                    ------
     <---------AHL12(3)                              <-----------GT1                         <------
    <---------AHL25(3)                            --------->KAN4(2)                          -------
   <---------AHL20(2)                            <---------KAN4(1)                           <------
   --------->AHL20(2)                            --------->KAN4(1)                           -------
   <---------AHL25(1)                            --------->KAN1                              <------
   --------->AHL25(3)                            <---------KAN1                              -------
   --------->AHL25(1)                           ---------->TaMYB80                         ---------
------>ANAC46       --------->ANAC58            <---------KAN4(2)                          ---------
--->KAN4(2)         --------->ANAC46          ========================HOX2a_HOX2a          <--------
----TaMYB80         --------->ANAC58          <------ZmHOX2a(1)                            ---------
---GLK1(1)     --------->ZAT18              --------->LBD16                                <--------
-->CCA1(2)     --------->ZAT14             <---------LBD16                                 ---------
---KAN1        <---------ZAT18             --------->HSFB2a(2)  --------->YAB5             ---------
--RVE1(2)  --------->DAG2               --------->GATA12       <------ZmHOX2a(2)    ----------->GT1
->ARR11(2)---------->DOF2               <---------GATA12<---------ALFIN1           ----------->GT1 <
 
acccaaataaatataaagttcacacgaaaaaaacttggaatcacatccaggaatattcaccactggatcaatactactatacaacaagggaaaaaaaaat  9414200
------>AHL12(2)
-------AHL12(2)
------AHL25(3)
---->AHL12(1)
---->AHL12(3)
-----AHL25(1)
-----AHL25(3)
-----AHL12(3)
-----AHL12(1)
---->AHL20(2)
---->AHL25(1)
--->AHL12(1)
--->AHL25(3)
----ARR11(3)
--->AHL20(1)
----AHL20(1)
--->AHL25(2)
----AHL12(1)
----AHL25(2)
----AHL12(2)
--->AHL12(2)                               <-------TEIL                                  ------>ZmHOX2a(2)
--->ARR11(3)                              --------->CCA1(2)                             <---------YAB1
---AHL25(2)                              <---------ARR11(2)                            <---------ARR11(3)
-->AHL25(2)                              --------->ARR14(2)                            --------->ARR11(3)
---AHL12(3)                              --------->GATA12                             --------->YAB1
-->AHL12(3)                              --------->ARR11(1)                           -------->HAHB4
---AHL12(2)                              <---------GLK1(2)                           <---------YAB1
-->AHL12(2)                              <---------ARR14(2)                          <---------YAB5
>AHL20(2)                                --------->ARR11(2)                          --------->ICU4
>AHL25(2)                                <---------GATA12        <---------ALFIN1  --------->YAB1
-AHL20(3)                               --------->KAN1      ------>NtERF2  <----------DOF2
>AHL20(3)    ---------->TaMYB80        ----------->ARR10   <---------DEAR3(1)      <---------ICU4
-AHL12(3) ----------->GT1          --------->ANAC58        --------->DEAR3(1)     <---------ATHB12
>AHL12(3) <------MYB83             --------->ANAC58       --------->ATERF1(1)     <---------ATHB51
>AHL25(1) <------MYB46(1)        ---------->DOF2        ----------->HVH21 <---------DOF5.7(1)
---------AHL20(2)       <---------AHL20(2)--------->ARR14(1)<---------DEAR3(2)    --------->ICU4 ---
 
atttaacttgggaaggtatatacttattttataaacaaaagcaagattcgccttgtaatgcgacggcccgacttctctctttcaaataatgatccttgag  9414300
                                                                                   --------->AHL12(1)
                                                                                   --------->KAN1
                                                                                   <---------AHL12(1)
                                                                                   <---------ICU4
                                                                                   --------->ATHB51
                                                                                   -------->ATHB1
                                                                                  --------->ICU4
                                                                                  <---------ATHB51
                                                                                  <---------ATHB12
                         <---------------AGL15                          <---------TOE2(3)
                         <----------DOF2                                <---------TOE1(3)
                 <-------TEIL         <---------MYB59                  <---------DOF5.7(2)
             --------->ARR14(2) --------->DOF5.7(1)           <---------DAG2    --------->WOX13(1)
            ----------->TBP----------->TBP                    <----------DOF2 <---------YAB1     <--
------>GLK1(1)--------->KAN1  ---------->DOF2 <---------CCA1(2)*TSS    ---------->DOF2        ------
 
aaaccctatagagccatatatacgttgtctttataaagagacataactcatctcttcttgactaactttatagttaaagttatcaattattcgaaaacaa  9414400
                                                                      <---------ANAC55(2)
                                                                      ----------->GT1       <-------
                                                                     <-----------------------TaNAC69(2)
                                                                   --------->ARR11(2)    <-------TEIL
                                                             --------->WOX13(1)     <---------ANAC58
                                                          --------->YAB5            <---------ANAC46
                           --------->YAB1  <---------ANAC55(2)     <---------ARR11(2)<--------------
                    ---------->DOF2        --------->ANAC55(2)  --------->YAB1      <---------ANAC58
-------ZAT2   ---------->ID1         <---------ARR11(3)   --------->YAB1       <-----------RAV1(1)--
---->DOF2  --------------->AtSPL8    --------->ARR11(3)  <---------KAN1 ----------->GT1 <---------KAN1
 
agctggttttttgttttgtcccttaaaccagcatgatcaagaacttaagtaatatgaagaatgacaatcagaaacgtgaaaaatgttgcgagtacatcga  9414500
                                                     <---------ANAC46
                                                     <---------ANAC58
                                                     <---------ANAC58
                                                 <----------DOF2
                                                <---------DOF5.7(1)
            <---------KAN1                     ------>ZmHOX2a(1)
 --------->HSFB2a(2)  <------ZmHOX2a(2)  <---------At4g35610
 <---------HSFB2a(2)  ================================HOX2a_HOX2a
--------------WRI1   --------->ARR11(3)  <---------ZAT2                                   <---------
-AtSPL8>>>>>>>>>TBF1 <---------ARR11(3)  --------->At4g35610                   <-------TEIL
------->ARR11(3)     --------->RVE1(2)   --------->ZAT2                    <-------TEIL------->TEIL
 
agctctcgaagaagaacgtcgcaagatcaatgttttccaacgcgagcttcctctttgcgtagagctcgtgactcaaggtacatacatatgcatttacatt  9414600
                                              <---------YAB5
                                            ---------->DOF2
                                          ------>ZmHOX2a(2)
                                        --------->AGP1
                                        <---------RVE1(2)
                                        <---------ARR11(3)
                                        --------->RVE1(2)
                                        <---------GATA12
                     <---------AHL20(2) <---------AGP1
                     <---------AHL12(3) --------->ARR11(3)
                 --------->AHL20(2)     --------->GATA12                                    --------
           <---------YAB5      <---------AHL20(2)<---------RVE1(1)                       <---------ARR11(2)
        <---------AHL20(2)    --------->AHL25(1)<---------GLK1(2)                     <---------ANAC58
      --------->CCA1(2)       --------->AHL20(2)<---------ARR11(3)                    <---------ANAC46
     <---------ARR11(3)       <---------AHL25(1)--------->ARR11(3)                   <--------------
--GT1--------->ARR11(3)   ----------->GT1<------ZmHOX2a(2)              <---------KAN1<---------ANAC58
 
tcatataagatataatgagtttatatatatggattaaatgttagatctaaagatttttaaaaaatgttttatggaatttagcgattgaggcgtataagag  9414700
                                                                                  <---------ARR14(2)
                                                                                  --------->ARR14(2)
             <---------DEAR3(1)                                                   --------->ARR11(2)
             --------->DEAR3(1)                                                   <---------AGP1
             --------->ETT(2)                                                     --------->GATA12
          --------->TGA1a                                                         <---------ARR11(2)
          <---------TGA1a                                              <---------PCF2
          <---------bZIP60(2)                                       --------->ALFIN1------>ZmHOX2a(2)
          <---------ANAC46                               --------->MYB52(1)       <---------GATA12
    <---------LBD16                                     --------->AtMYB61   <---------KAN1
 <---------GLK1(1)                                --------->At4g35610<---------RAP2.3(3)
 --------->GLK1(1)                                --------->ZAT14 <-----------RAV1(1)            <--
 --------->KAN1<---------LBD16             --------->ZAT14        <---------KAN1 <---------CCA1(2)
 --------->CCA1(2)                         <---------ZAT14  --------->LBD16<---------GATA12     ----
<---------ARR11(3)                     <------NtERF2   --------->MYB46(3)  ------->TEIL         ----
--------->ARR11(3)          <---------LBD16--------->ZAT18<---------LBD16  <---------ARR14(2)   ----
->DOF5.7(1)  <---------ETT(2)    --------->KAN1   <---------At4g35610<---------DEAR3(1)        -----
---------TaNAC69(2) <---------KAN1  <---------------------WRI1   --------->GLK1(2)<---------RVE1(2)
 
ggagatatcagggacgtcgacggataacttatacggacagtcggagtgctcagagcagaccaccggagaatgtgggcgcatcttggatctgttcatacca  9414800
                                                  --------->YAB5                            --------
                                                 --------->ICU4                         <---------YAB1
                                               --------->YAB5                       <---------GLK1(2)
                                               --------->YAB1                       <---------ARR11(3)
                                              --------->ICU4                        <---------GATA12
  --------->KAN1                         --------->YAB1                             --------->ARR11(3)
-------ATHB12                         ---------->DOF2                               <---------RVE1(2)
-->MYB83                           --------->YAB5<---------YAB1              ----------->RAV1(1)
-->MYB46(1)                    <-------TEIL   <---------YAB1                --------->DREB2C(2)
----->RVE1(2)            --------->DOF5.7(1)--------->YAB5                 --------->DEAR3(2)   ----
---->WOX13(1)--------->AtMYB61<--------P--------->DOF5.7(1)                --------->MYB46(3)   ----
 
atcaaacactcttcgacctccatagaagaagaggttgatgacaaagatgatgatgatgaagaacaccagtctcatgaaaccgacatagattttgatgaca  9414900
<- Previous    Next ->

AGI:  At3g25790.1   
Description:  myb family transcription factor. similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:AT1G13300.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42100.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 9414364    to: 9416240    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.