Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   --------->HSFB2a(2)                                           <---------ANAC58<--
   --------->ARR11(2)                                                            <---------ANAC58---
-------->ANAC58    --------->TOE2(3)                                             <---------ANAC55(1)
-------->ANAC58    <---------HSFB2a(2)                                           <---------ANAC46---
----->HVH21 <---------CCA1(2)         ----------->GT1                       --------->YAB5  --------
--TGA1a   <---------CCA1(2)         <---------ANAC58                        <---------ICU4  --------
--KAN1  <---------DOF5.7(1)         <---------ANAC46                       <-------TEIL<---------RVE1(2)
->TGA1a------>ZmHOX2a(1)            <---------ANAC58        <-------TEIL   <---------YAB5 <---------ALFIN1
acacggtttcctcttatctcttccataaactcagccatagcctgtaaaaaatgacagaaaatgttcatgagaaatggattcattacttgtgatacacgtc  26349600
--TGA1a   <---------WOX13(2)
->ANAC46  --------->WOX13(2)
->O2     --------->ATHB12                 <---------DOF5.7(1)   --------->YAB1
--O2  <---------DOF5.7(1)                <---------DAG2        --------->ICU4
-------->ARR11(2)                        <----------DOF2       <---------YAB1
-------At4g35610                   --------->At4g35610    --------->ANAC58
------>At4g35610                   <---------HSFC1(2)     --------->ANAC58                <---------
-------->GT1 <---------AHL20(2)    --------->HSFC1(2)   <---------ANAC58              <---------ARR11(3)
->ANAC58<---------YAB1       ---------->DOF2            --------->KAN1              --------->ANAC58
->TGA1a<----------DOF2  --------->DOF5.7(1)             <---------ANAC58            --------->ANAC58
aggttactctctttattgaatttgagaaaaatgaaagaagcttacttttttgaattcaggcatgccatgatagtcttgaaatagagcaagctctctgaaa  26349700
   <---------WRKY18(1)     --------->O2
   <-----------GT1         --------->TGA1a        --------->YAB5
  ----------->HVH21       --------->LBD16      <---------ICU4                                      <
  --------->WRKY12  <---------ANAC58           --------->YAB5                                     <-
  --------->WRKY38(1)     ------>NtERF2        --------->YAB1           <---------ZAT2         -----
 <---------WOX13(1) <---------ANAC58     <---------WOX13(2)  <---------GATA12    <---------RAP2.6(2)
--------AGL3------>ZmHOX2a(1)            --------->WOX13(2)  --------->GATA12<----------DOF2 -------
atggattgaccgttcctcttgagacttgccgcgtctgggttcttagttaaccatgactcgattagatcgaaacatagctggttttcggctagacccatct  26349800
                         <---------YAB1  --------->TOE1(1)                                     -----
          <---------TOE2(3)    <---------YAB5                                              <--------
--------->KAN1       ------>ZmHOX2a(2)   --------->TOE2(1)                        ----------->HVH21<
------ZmHOX2a(2)     ==================HOX2a_HOX2a                        <---------ANAC58 <--------
--------ARR11(3)   --------->GATA12     --------->HSFB2a(2)               <---------ANAC58 <--------
---->HSFB2a(2)     <---------GATA12     <---------HSFB2a(2)          <---------KAN1<---------WRKY18(1)
---->RAV1(2)       <---------ARR11(3)   --------------->AtSPL3     <------ZmHOX2a(1) <---------YAB1<
ggatcatcccattagggttcttgatctcatcataaggattcttctcgtactcttcccatcccaagaagtaggatgagtcttgtccatgaccattgcttgt  26349900
     --------->ETT(2)                      --------->GLK1(2)                <------ZmHOX2a(1) ------
----->ID1                                 <---------GLK1(2)                 ========================
-ANAC58                                   <---------RVE1(2)                 ========================
---------DAG2                             --------->ARR11(3)           ----------->HVH21     -------
-ANAC58   <---------At4g35610             <---------ARR11(3)        <---------MYB46(3)  --------->DOF5.7(1)
-ANAC46---------->DOF2                   <---------RVE1(1)         --------->ALFIN1--------->ANAC58
----------DOF2   --------->KAN1---------->DOF2<---------AtMYB61  <-----------RAV1(1)  ---------->DOF2
cacttttgtcgaaagctgtttcattctctgtttttaaagtcaagagattttggtcgtagagaagactaatgtgggtgaaggagagaacgaaaagaagaga  26350000
      <---------TOE1(3)                                             <-----------TBP--------->AHL12(2)
      <---------TOE2(3)                                             --------->AHL12(3)
  <---------WOX13(2)                                                --------->AHL20(2)
  --------->WOX13(2)                                                <---------AHL12(3)
--->ZmHOX2a(2)                                                    <---------AHL12(3)
---ZmHOX2a(2)                                                     <-----------TBP  <---------AHL12(2)
-----ARR14(2)                                                     <---------AHL20(2)
---->AGP1                                   ------------>CBF      --------->AHL20(2)
---->ARR14(3)                              --------->ANAC58       --------->AHL12(3)  --------->RVE1(2)
-----RVE1(2)                           <---------HSFB2a(2)      <---------AHL12(3) <---------AHL20(3)
-----ARR11(3)                         <------MYB83              <-----------TBP  --------->ICU4    -
---->ARR14(2)                         <------MYB46(1)           --------->AHL12(3)--------->YAB1   <
---->ARR11(3)                        *TSS  --------->ANAC58     --------->AHL25(1)<---------ICU4   -
-----ARR14(3)                       <--------P                <---------KAN1     <---------YAB1    <
-----GATA12                        <-------GAMYB              <-----------TBP   --------->AHL20(3) -
---->GATA12                       <---------MYB46(3)         <---------RVE1(2)  --------->AHL25(2) -
----GLK1(1)                      --------->ALFIN1       <---------MYB52(1)      <---------AHL20(3) <
--->GLK1(1)                   <---------GATA12         <-------GAMYB<---------AHL20(2)--------->GLK1(2)
====HOX2a_HOX2a               --------->GATA12        <-----------RAV1(1)      --------->YAB1     --
===HOX2a_HOX2a   <------MYB46(1) <---------AtMYB61    <---------MYB46(3)     <---------RVE1(2)    --
---->ARR10       <------MYB83 <---------RVE1(2)       <---------DEAR3(2)   ----------->GT1--------->MYB52(1)
tcttgaattagggtttaagttggtgaagagtgagatgtggttggagaagcaatgggtctgttgggatatatatatatatagataataataatctaacgac  26350100
         --------->YAB1                                                                            =
 --------->WOX13(2)                                                                                <
 <---------WOX13(2)                                                                           ------
<---------AHL12(2)                                                                            ------
-------->AHL20(2)                                                                    --------->KAN1-
---------AHL20(2)             --------->YAB1               --------->HSFB2a(2)       <---------AHL12(1)
-------->AHL25(3)           --------->RVE1(2)              <---------HSFB2a(2)       --------->AHL12(1)
---------AHL25(3)           --------->GLK1(2)           <---------SPL7(1)           --------->AHL12(2)
-------->AHL12(3)        ------->GAMYB               <---------At5g28300            <---------YAB5 -
-------->AHL25(1)     ----------->RAV1(1)           <---------WRKY18(1)             --------->ICU4 <
---------AHL25(1)    <---------bZIP60(1)            <-----------GT1            ----------->GT1------
------->AHL25(3)     --------->bZIP60(1)       <---------DOF5.7(1)   --------->TOE2(3)<---------GLK1(2)
------->AHL20(2)----------->GT1               <----------DOF2       <---------YAB1  <---------AHL12(2)
atttaatttcaaaaataaaatgtgacaacagaatcagaaactagagagacttttttgaccgtccagacattaccatagtttttagtaaatattctccaag  26350200
                                        --------->AHL12(2) <---------AHL25(1)
                                        <---------AHL12(2) <---------AHL20(2)
                                       --------->YAB5      <---------AHL25(3)
                               <------ZmHOX2a(2)         --------->AHL12(2)
                               --------->GLK1(1)       --------->AHL20(2)
                              --------->GATA12 --------->ANAC58
                       <---------AHL20(2)      --------->ANAC46
                       <---------AHL25(1)  <-----------GT1--------->AHL20(2)
                     --------->AHL12(2)--------->YAB1 <---------AHL20(2)
                   --------->AHL20(2)  <--------HAHB4 --------->AHL12(3)              --------->ZAT14
========================bZIP_DOF       <--------ATHB1 <---------AHL25(2)              <---------ZAT14
---------TGA1a     --------->AHL12(1)  <---------ICU4 <---------AHL25(1)          <---------ICU4
--->ANAC58         <---------AHL12(1) <---------ATHB12<---------AHL12(3)     --------->AHL20(2)
--->ANAC46        <---------YAB1------>ZmHOX2a(2)     --------->AHL25(3)     --------->YAB1
-------->O2      --------->AHL12(2)   --------->AHL20(2) <---------AHL12(2)--------->WOX13(2)
-------->TGA1a <---------AHL20(2)     <---------ATHB51<---------AHL20(3)   <---------WOX13(2)
---------O2    --------->AHL20(2)     --------->ICU4  --------->AHL20(3)  --------->YAB5
--->ANAC58   <----------DOF2  <---------GATA12 --------->ANAC58      --------->AHL20(2)      -------
acatgtgagacaacttcttttattatttaatgcgatctccaataattaacaagctatattatttaatacaaaataaacaattaaaacattgcagtagttc  26350300
                           --------->ATHB51                                        <---------YAB1---
                           -------->ATHB1    <---------ICU4                   <------ZmHOX2a(1)-----
                           --------->ATHB12  --------->ATHB12                <---------YAB1 <-------
                          <---------YAB1     --------->ATHB51               <---------TOE2(3)<------
                       ------>ZmHOX2a(2)    <---------YAB1             <---------ARR11(3)  ---------
                     --------->ARR11(3)     <---------YAB5             <---------GATA12  <---------WOX13(2)
                     <---------ARR11(3)    --------->AHL12(2)          --------->ARR11(3)--------->WOX13(2)
                   <---------KAN1          <---------AHL12(2)        <---------AHL25(3)--------->AHL20(2)
                   <---------YAB5         <---------AHL20(2)         <---------AHL12(1)<---------AHL20(2)
                 --------->YAB1          --------->AHL25(3)         <---------ATHB12--------->YAB5<-
   <----------DOF2<---------KAN4(2)      --------->AHL20(2)  <-------TEIL   <---------TOE2(2)-------
-->ARR11(3)   --------->YAB1       --------->GLK1(2)         ---------->DOF2<---------TOE1(2)<------
ttgtttctttttgaaaataagaatgatctattattgagtttctatttattattgcattcacacatacagcaataaatcttaggattatgtttaaataaaa  26350400
                                                             --------->AHL20(2)                    -
                                                            <---------AHL12(3)                     <
                                                            --------->AHL20(1)                     <
                                                            --------->AHL25(1)                     <
                                                            <---------AHL25(1)                    --
                                                            <---------AHL12(1)                    <-
                              <---------AHL12(2)            --------->AHL12(1)                    --
                              --------->AHL12(2)            <---------AHL20(1)                    --
                             <---------AHL25(3)             --------->AHL20(2)                    <-
                             <---------AHL20(2)             --------->AHL12(3)                    <-
                            <---------AHL20(2)              <---------AHL25(3)                    <-
        --------->ZAT2      --------->AHL12(3)              --------->AHL25(2)                ------
------->AHL20(2)            <---------AHL25(1)              --------->AHL25(3)               <------
-->AHL20(2)                 <---------AHL12(3)              <---------AHL20(2)               <------
-->AHL20(3)                 --------->AHL12(1)              <---------AHL25(2)               -------
-->AHL25(2)                 --------->AHL25(1)             <---------AHL12(2)               --------
->YAB1  --------->At4g35610 <---------AHL12(1)             --------->AHL12(2)               --------
------>AHL20(2)             --------->AHL20(2)             --------->AHL12(3)              ---------
---->YAB1                   --------->AHL25(2)             <---------AHL12(3)            <---------KAN1
--AHL25(3)                  --------->AHL25(3)             --------->AHL25(2)        --------->ANAC58
---AHL12(3)                 <---------AHL25(3)             <---------AHL25(2)  <------ZmHOX2a(1)  --
>AHL20(2)--------->AGP1   <---------WOX13(2)              --------->AHL12(2)--------->HSFB2a(2)  <--
--------AHL25(3)          --------->WOX13(2)      <----------DOF2    ------>ZmHOX2a(2) --------->YAB1
-->AHL12(3)        <----------ID1            <---------At4g35610   <---------RVE1(2) --------->ANAC58
---AHL20(3)  <---------REM1(2)--------->WOX13(2) <---------DOF5.7(1) =================HOX2a_HOX2a---
ataaaaaaaccagctctacatagggacaaaattaaataacacattttgagcttctttccaaaatttatttgatcgttttctaggattcaagcatatttaa  26350500
<- Previous    Next ->

AGI:  At5g65800.1   
Description:  ACS5 (ACC SYNTHASE 5); 1-aminocyclopropane-1-carboxylate synthase. Identical to 1-aminocyclopropane-1-carboxylate synthase 5 (ACS5) [Arabidopsis Thaliana] (GB:Q37001;GB:O49537;GB:Q9S9C3); similar to ACS8 (1-Amino-cyclopropane-1-carboxylate synthase 8) [Arabidopsis thaliana] (TAIR:AT4G37770.1); similar to ACS4 (1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE 4), 1-aminocyclopropane-1-carboxylate synthase [Arabidopsis thaliana] (TAIR:AT2G22810.1); similar to ETO3 (ETHYLENE OVERPRODUCING 3), 1-aminocyclopropane-1-carboxylate synthase [Arabidopsis thaliana] (TAIR:AT3G49700.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74730.1); similar
Range:  from: 26347972    to: 26350038    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.