Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                <---------ALFIN1                  <---------RVE1(2)
             --------->GATA12            <-----------GT1
          --------->YAB1                ----------->HVH21
         <---------ATHB12             <---------ANAC55(2)                      ---------->DOF2    <-
       --------->WOX13(1)             --------->ANAC55(1)                <---------ARR11(2)     ----
     XXXXXXXXXXXXXXXXXXXX>MIR3440B-5P ----------->GT1                 <---------ZAT6    <---------KAN1
--------YAB1 <---------GATA12         --------->ANAC55(2)         <---------YAB1--------->DAG2<-----
 
tatgttttctcaatcacatccacttcttaagaagacataacatgtaacatgttgatatgaaaccatgtgattagtggaaatgaaaagcagaatgtaagga  25986000
                                                    --------->ANAC58
                                           <----------DOF2
                                  --------->ATHB12  --------->ANAC58
                                 <---------YAB1     --------->ANAC46
     <-----------HVH21--------->YAB1<---------WOX13(1)
--------ARR11(2)     <---------ATHB12 --------->KAN4(2)
------->GT1         --------->RVE1(2)<---------MYB46(3)----------->RAV1(1)     --------->MYB46(3)  -
-ZmHOX2a(1) <---------KAN1   <-----------GT1      ---------->DOF2      <---------KAN1---------->DOF2
 
ggttacaatgtcagaacatagcaaatcatatataacttgattgttcctttcttcaaagcaacaatggaattggaatatagcatccactaaaagccttcaa  25986100
               --------->KAN1
              --------->ICU4                                                                    ----
             <---------AHL20(3)                                                             --------
             --------->AHL20(3)                                                          <---------ANAC55(2)
          <---------ARR11(3)                           <---------YAB5                    <---------ANAC58
   --------->TOE1(2)                                --------->ICU4                 <---------MYB52(1)
   --------->TOE2(2)                             --------->YAB5                  <---------ANAC58
  --------->YAB1                             --------->ICU4                      <---------ANAC55(2)
 <---------YAB5<---------ICU4                --------->DOF5.7(1)                 <---------ANAC58
 <---------ATHB12                          ---------->DOF2                       --------->ANAC55(2)
------>MYB46(1)-------->HAHB4        --------->ANAC58<---------ICU4 --------->KAN1--------->LBD16 --
------>MYB83--------->YAB1           --------->ANAC58--------->YAB5 <---------ANAC58     --------->ANAC55(2)
-------->WOX13(1)                    --------->ANAC46--------->YAB1 <---------ANAC58     <---------ANAC58
 
accaatcatacgagataataatgcgatttcaaaactgatcaagccataaagatgaataatgagccatagttgcattcgttcaatccgtgatttcgtaacg  25986200
                                                                              <---------KAN1
                                                                     <---------YAB1
                                                                   --------->YAB1                  -
                                                                   <---------ICU4                 --
          --------->TOE2(3)                                       <---------ATHB12          --------
 <----------ID1                    <---------WOX13(1)       ----------->HVH21------->TEIL--------->YAB1
--------->DOF5.7(1)         ---------->DOF2      --------->MYB52(1)--------->YAB5      --------->RVE1(2)
----->ANAC46 <---------WOX13(2)   --------->WOX13(2)      <---------O2    <---------YAB1<---------ATHB12
-->DOF2  ----------->GT1--------->RVE1(2)   <----------ID1--------->O2  --------->CCA1(2)--------->YAB5
-------->DOF2--------->WOX13(2)   <---------WOX13(2)  ------->TEIL--------->ICU4      --------->WOX13(1)
 
cgaaaggccaaaacgttattaagttccaatccaaagtaattgacaaaaaaacaaatggacctcgtgacaatgatgatatgaatctctcccaatcacaaaa  25986300
                                                                           --------->ANAC58
                                                                         --------->DEAR3(1)
                                                                      --------->ANAC46
                                                                      --------->ANAC58
                                                                 <---------WOX13(1)
                                                                <------------CBF
                                                               --------->ATHB12
                                                              <---------YAB1               <--------
                                                             --------->At5g28300          <---------ATHB12
                           <---------ZAT6                   <---------ANAC58      --------->KAN1
                     --------->YAB5                         <---------ANAC58     --------->AHL20(2)
    <---------MYB52(2)     ----------->GT1               ------->GAMYB--------->ANAC58    --------->ICU4
    --------->MYB46(3)    <---------TOE2(3)             --------->MYB46(3) --------->ANAC58---------
XXXXXXXXXXXXXXXXXXXX>MIR851-3P       --------->YAB5    --------->At4g35610------>NtERF2 --------->YAB1
---------->GT1      --------->DOF5.7(1)<---------YAB1 --------->MYB52(1) --------->RAP2.6(2) <------
------->YAB5--------->ZAT6<---------TOE1(3) ----------->GT1<---------DEAR3(1)   ----------->TBP   --
------->AGL15     ---------->DOF2    --------->YAB1--------->RVE1(2)---------->DOF2    <---------YAB1
 
atgagtaacaaacaaacactaaaaagattagggttaaaaatcataaatagtcaaaatcaacggccgtgattgaaagccaccctataaattctaataatca  25986400
                                                                      <---------ANAC58
                                                                      <---------ANAC58
                                                                      <-------GAMYB
                                                      <---------GLK1(2)
                                                      <---------RVE1(2)
              *TSS                                    --------->ARR14(2)
            <------------CBF<-------GAMYB             --------->ARR11(2)
-ICU4    >>>>>>>>>>>>>>>>>LFY                         <---------ARR14(2)                 --------->ANAC58
>YAB1   --------->ANAC58   <---------ANAC58     --------->ALFIN1  --------------------->WRI1
---YAB5 --------->ANAC58   <---------ANAC58     <-----------RAV1(1)  <---------MYB46(3)  --------->ANAC58
------->GLK1(2) <---------YAB1           --------->ZAT6--------->GLK1(2)  <---------AtLEC2     <----
 
gtttctgagtgaagccattgttatttgttttcgttgccactctaacacaatgtgtgggattctcgctgttcttggttgcatcgacaactctcaagctaaa  25986500
                                                    <---------ICU4                      <---------AHL20(2)
                                                    --------->YAB1                      <---------YAB1
                                                    --------->YAB5                     --------->AHL12(2)
                         <---------ARR14(2)        <---------ATHB12                   --------->YAB1
      <---------YAB5     --------->ARR14(2)        --------->ICU4                 ----------->GT1
    <---------CCA1(2)  <---------TOE2(2)         --------->WOX13(1)              <---------YAB5    -
-----YAB5              <---------TOE1(2)       <---------YAB5                   --------->GLK1(2) <-
 
cgttctcgtatcatcgaactctctcgcaggtactcttctgtttccattgaatcaatcatgaagcctgcccaatgttactgaagaatcgtttataatttgg  25986600
                                  --------->ARR11(2)
                                  <---------ARR11(2)                                    <---------DOF5.7(1)
                                  <---------ARR14(2)                             <------MYB83
                                  --------->ARR14(2)                             <------MYB46(1)
                                 --------->DOF5.7(2)                             ----------->GT1
                               <---------ANAC58                                  <---------MYB46(3)
                           --------->ALFIN1                                    <---------WOX13(1)
           <---------DAG2  <---------ANAC58             <---------RVE1(2)     --------->GATA12
           <----------DOF2 <---------ANAC58        --------->YAB1             <---------RVE1(2)
           <---------DOF5.7(1) <---------ANAC58   <---------YAB5             <<<<<<<<<RAP2.2    <---
 <---------TOE2(3)     <---------GLK1(1)         ------->TEIL               <---------TOE2(3) <-----
--------->DOF2        <---------ARR11(2) --------->WOX13(2)             --------->YAB5 <----------DOF2
--------KAN1         <------ZmHOX2a(1)   <---------WOX13(2)           <---------TOE2(3)<---------DAG2
 
aataaaggtttcaacttttttagaggaaatgtgtgcgtttactcaattgatgaatcatagatagacccgaattgatgtttagattggttacttttttttg  25986700
                             <---------ZAT14                                       <---------WRKY18(1)
                             --------->ZAT18                                      --------->WRKY38(1)
                             --------->ZAT14                                      --------->WRKY12
                             <---------ZAT18                                   <---------ICU4
                            --------->ALFIN1                                   -------->ATHB1
                          <---------ANAC46                                     --------->ATHB12
                      <---------WOX13(1)                <---------ANAC58      <---------ATHB12
                    --------->ATHB12                    <---------ANAC58      <---------YAB5
 <---------GATA12  ------>ZmHOX2a(1)                  --------->ARR11(3)      --------->ICU4    <---
------ANAC46       --------->ICU4             <---------YAB1                  <---------YAB1   <----
----ANAC46         <---------YAB1          <---------YAB1     --------------------->WRI1     <------
 
tgtagattgaggcacagaggtcctgattggagtggactccattgttatgaagattgttatcttgcccatgagcgtttagccatcattgaccctacttcag  25986800
    --------->MYB46(3)                      <----------DOF2
   -------->P                             ------->TEIL
   ------>MYB83                         <---------ZAT14                                  <---------AHL25(3)
   ------>MYB46(1)                      --------->ZAT14                                 --------->AHL20(2)
 --------->AtMYB61                      <---------ZAT18                           ----------->GT1 --
 <---------MYB59                      --------------->AtSPL8            --------->YAB1  --------->AHL25(1)
---ZmHOX2a(1)                     <-----------HVH21                   <---------WOX13(2)<---------AHL20(2)
-----At4g35610                <---------DEAR3(1)                     --------->WOX13(1)--------->AHL12(2)
-----RAV1(2)       xxxxxxxxxxxxxxxx>smallRNA(s)        <----------DOF2--------->WOX13(2)<---------AHL25(1)
 
gagaccaacctctctataacgaagacaagaccgtcgctgtcactgtactttctcttgtctttcaaacaatgtcaattagtatcatgtgtaaataaatgtg  25986900
<- Previous    Next ->

AGI:  At5g65010.1   
Description:  ASN2 (ASPARAGINE SYNTHETASE 2); asparagine synthase (glutamine-hydrolyzing). similar to ASN3 (ASPARAGINE SYNTHETASE 3), asparagine synthase (glutamine-hydrolyzing) [Arabidopsis thaliana] (TAIR:AT5G10240.2); similar to ASN1 (DARK INDUCIBLE 6) [Arabidopsis thaliana] (TAIR:AT3G47340.1); similar to ASN3 (ASPARAGINE SYNTHETASE 3), asparagine synthase (glutamine-hydrolyzing) [Arabidopsis thaliana] (TAIR:AT5G10240.1); similar to unknown [Populus trichocarpa] (GB:ABK95431.1); similar to 52O08_30 [Brassica rapa subsp. pekinensis] (GB:AAZ67575.1); similar to 117M18_15 [Brassica rapa] (GB:AAZ66934.1); contains InterPro domain Asparagine synthase, glutam
Range:  from: 25986415    to: 25989801    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.