Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             ---------->DOF2                                                       -
                      <---------ZAT14                          --------->ANAC58                <----
              <---------ANAC46                                 --------->ANAC58                -----
              <---------ANAC58    ---------->DOF2              --------->ANAC46              -------
     <---------YAB1   <---------ZAT18                        <---------KAN1                  -------
    --------->TOE2(3) --------->ZAT18                    ----------->RAV1(1)                <-------
  <---------GATA12    --------->ZAT14                 --------->ANAC58                    <---------MYB46(3)
  <-----------ARR10 <---------ZAT18                   --------->ANAC58                  <---------At4g35610
  --------->GATA12 <---------ANAC46                   --------->ANAC46               ===============
  --------->RVE1(2)<---------ANAC58           <---------At4g35610                    ------>ZmHOX2a(1)
 <---------CCA1(2) <---------ANAC58      ------>ZmHOX2a(1)--------->At4g35610       --------->TOE2(3)
----ATHB12    <---------ANAC58 ----------->GT1--------->At4g35610                --------->GATA12---
 
agtcaaatcttattgtgtcttggtgtgcactgtaaagtaaagtcctgtctgcttcaaacgcagcataagcaaacttacaacttaaatcctcagccgttga  25925200
                            --------------->AGL15
                            ========================================================================
                            <---------------AGL15
                            <---------MYB59
                           --------->ANAC55(2)
                        <---------MYB52(1)                    --------->ANAC58
                        --------->DOF5.7(2)                <---------PCF2
         <---------GATA12  ----------------->AGL1          --------->TCP20
--------->DOF2        --------->ANAC46           <-----------------AGL3
-----GATA12          <---------TOE2(3)           ===================================================
---->GATA12       <---------YAB1             --------->ARR11(3)          --------->ANAC58
-->WRKY38(1)    --------->YAB1------>MYB83   <---------ARR11(3)          --------->ANAC46 ----------
-->WRKY12--------->RVE1(2) <---------ANAC55(2)--------->RVE1(1)  ---------->DOF2          <---------
--MYB52(1)     <---------ATHB12           --------->AHL20(2)  <---------ANAC55(2)         <---------
====HOX2a_HOX2a--------->ICU4 ------>MYB46(1)--------->RVE1(2)--------->ANAC58      --------->YAB5
--->ZmHOX2a(2)--------->WOX13(2)       ----------->GT1     --------->PCF5--------->ANAC58<----------
 
tccaaagaccaaaatccaattatcaacgttacctaatgtagacgataaaatctcttaaaatgggcccgtaaagcccaagcaaaaaaacaattactttaag  25925300
                                                                --------->KAN1
                                                     <---------O2
                                                     --------->bZIP60(1)
                                                     --------->O2
                                                     <---------bZIP60(1)
                                                     >>>>>>>>>>HY5
                                                     <<<<<<<<<<HY5
                                                     <---------ANAC55(2)         <-------MYC2
                                                     --------->TGA2(1)           ------->MYC4
                                                     <---------TGA2(1)           ------->MYC2
                                                     --------->ANAC55(2)         <-------MYC3
                                                    <-----------STF1             ------->MYC3
                                                    ----------->STF1             -------->ABF1
                                                   <---------TGA2(2)             ------->PIF5
                                                  ----------->TGA1               <-------PIF5
              --------->DEAR3(1)                  ----------->HVH21    <---------DOF5.7(1)
       <----------DOF2                          <---------At4g35610   ====================bZIP_DOF--
       <---------DOF5.7(1)            --------->ANAC55(2)    <---------YAB5      <-------MYC4     --
   --------->ZAT18                    --------->ANAC58       <---------YAB1     --------->ANAC55(2)
   <---------ZAT18       <---------TOE2(3)      --------->At4g35610   <----------DOF2          -----
 <---------At4g35610    <-----------GT1     --------->MYB52(1)--------->YAB1    <---------O2  ------
 --------->At4g35610 --------->WOX13(2) --------->TGA2(2)  <---------ICU4       ====================
======MADS_MADS   <---------DOF5.7(1) <---------ANAC55(2)  --------->YAB1       ====================bZIP_DOF
======MADS_MADS------>NtERF2          --------->ANAC46    <---------YAB1        --------->ANAC46<---
----->AGL15   <---------ALFIN1        --------->ANAC55(1) --------->ICU4        --------->TGA1a-----
------AGL15--------->ANAC46           --------->ANAC58    <---------YAB5        --------->O2 <------
-DOF2  <---------DAG2<---------WOX13(2)<-----------TGA1--------->TGA2(2)        <---------TGA1a<----
-------AGL3<-----------GT1           --------->SPL7(1)<-----------TGA1<---------DOF5.7(1)---------->DOF2
 
tggaagctcacttttcgccacccttattaacgtctgtccatacgtcataacagatgacgtcatcatcatattccttttttcacacgtggcattgaagcac  25925400
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
     --------->RVE1(2)                                                                           ---
     <---------ARR14(2)                                                                          ---
     --------->ARR11(2)                                                    --------->TOE2(3)     ---
     --------->ARR14(2)                                                <----------DOF2           <--
     <-----------ARR10                                                 <---------DOF5.7(1)       <--
 ------>ZmHOX2a(1)                                 <----------DOF2    <---------DOF5.7(1)        ---
---->MYB46(1)                                     --------->YAB5     ------>ZmHOX2a(1)           <--
---->MYB83                                        <---------ICU4--------->YAB1                  ----
---->HSFC1(2)                                    <---------YAB5 --------->KAN1                  <---
->TEIL       --------->LBD16                    --------->GLK1(2)<-----------GT1                <---
==================MYC_MYB <---------------AGL15--------->YAB1 --------->WOX13(2)                ----
------DOF5.7(1)        ----------->HVH21     --------->WOX13(2)<---------YAB5                 ------
---->HSFB2a(1)        <---------WOX13(1)    --------->YAB1    --------->AHL12(2)             <------
---ALFIN1-------->P  <---------ANAC58       --------->AHL12(2)<---------AHL12(2)           <--------
-----HSFB2a(1)       <---------ANAC58      <---------AHL20(2) <---------WOX13(2)        ----------->GT1
 
cttcctagtatctaccctgaaattgcttgacataagtagtagttgtttaataatctttatctcttaattatcctcttttcttaacaaaaacttgttacaa  25925500
             --------->AHL12(3)
       --------->AHL20(3)
  <---------YAB1
 <-----------GT1
------->AHL25(2)
--------AHL12(2)
------->AHL20(3)
------->AHL12(2)
--------AHL20(3)
--------AHL25(2)
------ATHB1  --------->AHL20(2)
------>YAB1  <---------AHL12(3)
-------AHL25(3)
-------AHL12(1)
------>AHL25(1)
------>AHL20(2)               <---------YAB1
------>AHL12(1)             --------->YAB1
------>AHL25(2)      ----------->HVH21
-------AHL20(1)      ------->GAMYB
-------AHL25(2)   <-----------GT1
------>ATHB51--------->AHL25(1)
-------ICU4  <---------AHL25(1)
----->AHL25(3)    --------->MYB52(1)----------------------->TaNAC69(2)
------ATHB12 --------->AHL20(3)     <----------DOF2
------ATHB51 <---------AHL20(3)    <---------DOF5.7(1)
----->ICU4   <---------AHL20(2)<-----------GT1                                 <-----------GT1
--->YAB1 --------->AHL20(2) <---------ICU4                                 <----------DOF2
---YAB1<---------AHL20(3)  <---------YAB1                       --------->ARR11(3)
---GT1 --------->AHL20(2)--------->YAB5                         <---------ARR11(3)                 -
 
taattttcatttttatataaataactgaccattataactctttctcttctcttcttcacttgctctagttcttggatgctttaaacctctctctctctct  25925600
             <-----------GT1
        <---------AHL12(3)
        <---------AHL20(2)
        --------->AHL12(3)
        <---------AHL25(2)
        --------->AHL20(3)
        <---------AHL25(1)
        <---------AHL20(3)
      --------->AHL12(2)
      <---------AHL12(2)
      <---------YAB1
     <---------AHL25(2)
     <---------AHL20(3)
     --------->AHL25(2)
     --------->AHL12(3)
     <---------AHL12(3)
     <---------AHL25(3)
     --------->AHL20(3)
     <---------AHL12(2)
     --------->AHL12(2)
    --------->AHL12(3)
    <---------AHL25(1)
    -------->ATHB1
    --------->ATHB51
    --------->YAB1
    --------->AHL25(3)
    <---------AHL25(3)
    <---------ICU4
    <---------AHL12(1)
    --------->AHL12(1)                    --------->RVE1(2)
    <--------HAHB4                        <---------ARR11(3)
    --------->AHL25(1)                   <---------KAN1                          --------->At4g35610
    --------->AHL20(2)                  ------->TEIL                     ------->TEIL
    <---------AHL20(2)                *TSS--------->ARR11(3)          --------->ANAC55(2)
   <---------ATHB51                   --------->YAB5                  <---------ANAC58
   --------->AHL25(3)             --------->DOF5.7(1)                 <---------ANAC55(2)          <
   <---------ATHB12              <---------AHL25(1)                   <---------ANAC58        <-----
   --------->ICU4                <---------AHL25(2)                  --------------->AtSPL8  <------
  <---------WOX13(2)             --------->AHL25(2)                  <---------------AtSPL3  -------
  --------->WOX13(2)             <---------AHL12(3)                  --------------->AtSPL3  -------
----------->CBF                  --------->AHL20(2)                 <-----------GT1       <---------
 
ctctcaattatttttttttctatttcaaaaacaaaaaaaaatgaatatctctcaaaaccctagccctaattttacgtacttctccgatgaaaactttatt  25925700
                                                                                                  --
                                                                                                  --
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                         --------->At4g35610
                                                                                         <---------At4g35610
                                                                                     ------>ZmHOX2a(2)
                                                                                    <------ZmHOX2a(2)
                                                                                   --------->ARR11(3)
                                                                                   <---------ARR11(3)
                                                                                   --------->GATA12
  <---------MYB52(1)                                                              <---------GLK1(1)
-----------------AGL2                                                        <------ZmHOX2a(1)------
----YAB1                                                ----------->GT1      ==============HOX2a_HOX2a
---WOX13(2)                                           =====================================HOX2a_HOX2a
-->AHL12(2)                             ----------->HVH21  <<<<<<<<<<<<<<<<<LFY   --------->GLK1(1)
-->WOX13(2)                           <----------DOF2 <------ZmHOX2a(1)      ===============HOX2a_HOX2a
-DOF2 <---------TOE2(3)         <---------RVE1(2)<---------REM1(1)   --------->KAN1<---------GATA12
 
aatccgtttatggataacaacgatttctcaaatttgatgttctttgacatagatgaaggaggtaacaatggattaatcgaggaagagatctcatctccga  25925800
                                                                                                  --
                                                                                                 <--
                                                --------->ANAC58                                 <--
                                               --------->At4g35610                              ----
                                               <------NtERF2                                    <---
                                               <---------At4g35610                              ----
                                              <---------ATERF1(1)                               ----
                                       <---------RVE1(2)                                        ----
                                       --------->GATA12                                         <---
                                       --------->ARR11(2)                                       <---
                                       <---------ARR11(2)                                       <---
                                       <---------ARR14(2)                                      -----
                                       --------->GLK1(2)                                       -----
                                       --------->ARR14(2)                                      <----
                                      <------NtERF2                                            -----
                                     <---------ATERF1(1)                                       -----
                                     <---------MYB46(3)                                        <----
                                    <---------DEAR3(1)                                         -----
                                    <---------ANAC46                                           <----
                                   <---------LBD16                                             <----
                                   <------NtERF2--------->ANAC58                              ------
                                  <---------RAP2.3(1)                                         ------
                                 <---------DEAR3(1)                                           <-----
                                 <---------RAP2.3(2)                                          <-----
        <---------ANAC58 --------->LBD16   --------->LBD16                                    <-----
        <---------ANAC58 <---------LBD16   <-----------HVH21                                 -------
--------->YAB1          <---------LBD16<---------GATA12<---------------------WRI1            -------
------->ANAC58         <---------LBD16--------->ATERF1(1)                <---------YAB5      <------
------->ANAC58        <---------At5g28300<---------LBD16          ---------->DOF2 --------->GLK1(1)
---ETT(1)       <---------YAB5 --------->DOF5.7(1) ----------->RAV1(1)   <---------KAN1    ---------
---->HVH21   <------NtERF2--------->LBD16------>ZmHOX2a(2)   ----------->GT1     --------->MYB52(2)
-->ANAC46  <---------DEAR3(1)---------->DOF2 <---------DEAR3(1)   --------->DOF5.7(1)  <----------DOF2
>NtERF2 <---------ANAC46<---------ANAC46<------ZmHOX2a(2)    <---------ANAC46--------->O2  <--------
 
caagcatcgtttcgtcggagacatttaccggggaaagcggcggatccggcagcgcaacaacgttgagtaaaaaggaatcaacgtgagttcctttttaatt  25925900
 <-----------RAV1(1)
<---------YAB1
------->ATHB51
-------YAB5
-------YAB1
----->AHL12(3)
------AHL20(3)
----->AHL20(3)
----->AHL12(2)
----->AHL25(2)
------AHL25(2)
------AHL12(2)
------AHL12(3)
---->YAB1
---->ATHB51
-----AHL20(2)                                                              --------->AHL12(2)
--->ATHB1                                                                  --------->AHL12(3)
--->HAHB4                                                                  <---------AHL12(2)
-----ICU4                                                                 <---------AHL25(3)
---->AHL12(1)                                                             <---------AHL20(2)
----HAHB4                                                                 <---------ICU4
-----AHL25(3)         --------->ANAC58                                  --------->AHL12(2)
--->AHL25(3)          --------->ANAC46                                  <---------AHL12(2)
--->ICU4              --------->ANAC58                                 --------->YAB1
----YAB1              ------>MYB83                                    <---------YAB1
----ATHB51            ------>MYB46(1)                                <---------RVE1(2)
----YAB5      --------->TOE2(3)                                    <---------YAB1
-->WOX13(2) --------->GLK1(2)          --------->AHL20(2)      <----------DOF2
-->AHL12(2)<---------ARR11(3)      <---------AHL20(2)         <---------DOF5.7(1)
---WOX13(2)<---------GLK1(2)--------->YAB1                   <---------YAB5<---------AHL12(3)     --
>AHL20(2) --------->KAN1 --------->WOX13(1)             --------->TOE2(3)--------->AHL20(2)    -----
-AHL20(2)----------->ARR10 --------->ICU4             <---------YAB5--------->YAB1           <------ZmHOX2a(1)
 
attattgttggcaagattcttaaccaagcaattagtatttcattatatatagttttattcattaatctttttgataataaatattgtagtaatagaggaa  25926000
         --------->At4g35610<---------WRKY38(1)                  ----------->HVH21
         <---------At4g35610<---------WRKY12               <---------WOX13(1)
--------->DOF5.7(1)       <-----------HVH21         <------ZmHOX2a(2)                      <--------
-------->DOF2          <---------O2                --------->GATA12              <---------AHL20(2)
------>GT1         <------ZmHOX2a(1)               <---------GATA12 <---------WOX13(1)    <------ZmHOX2a(1)
 
gtaaagagagtgatcagacgaaggagacgggtcatcgagttgcatttagaacgagatcgaagattgatgtgatggatgatggttttaaatggaggaagta  25926100
<- Previous    Next ->

AGI:  At5g64810.1   
Description:  WRKY51 (WRKY DNA-binding protein 51); transcription factor. Identical to Probable WRKY transcription factor 51 (WRKY51) [Arabidopsis Thaliana] (GB:Q93WU9;GB:Q9LV96); similar to WRKY50 (WRKY DNA-binding protein 50), transcription factor [Arabidopsis thaliana] (TAIR:AT5G26170.1); similar to 80C09_12 [Brassica rapa subsp. pekinensis] (GB:AAZ41823.1); contains InterPro domain DNA-binding WRKY; (InterPro:IPR003657)
Range:  from: 25925639    to: 25927029    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.