Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                            --------->AHL20(2)   <---------ARR11(2)
                                            <---------AHL20(2)   <---------RVE1(2)
    <---------WRKY18(1)        ----------->GT1 --------->AHL25(1)<---------ARR14(2)
 <---------ANAC58         <---------YAB1   --------->AHL20(2)    --------->ARR11(3)
 <---------ANAC58    ------->TEIL     <---------YAB5 <---------TOE2(3) <---------ANAC46      <------
----->AtMYB61<----------DOF2<---------RVE1(2) --------->AHL12(2) --------->ARR14(2)----------->GT1
caatgcttgagcgaaactttgatgaaactctgatttgtataatcttttaaattattaatgtttgagtggatattgggtttacaaatttgttaaaaacttt  23636300
             <---------AHL20(3)                                         --------------->AtSPL8
             --------->AHL20(3)                                      --------->AHL20(2)
             <---------AHL20(2)                                   --------->YAB5
             --------->AHL12(3)                                  --------->ICU4       --------->AHL25(2)
             --------->AHL20(2)                                  <---------YAB1       <---------AHL20(3)
             --------->AHL25(2)                   --------->AHL20(2)<---------YAB1    --------->AHL20(3)
            --------->YAB1----------->GT1    --------->AHL20(2)--------->ANAC55(2)    <---------AHL25(2)
            --------->AHL25(1)             <---------ANAC46    <---------ANAC55(2)   --------->YAB1
            --------->AHL20(2)           ----------->GT1      <-------TEIL        --------->YAB1
---------->DOF2 --------->RVE1(2)    --------->DAG2      --------->AHL20(2)<-----------GT1
----DOF2  <---------WOX13(2)        ---------->DOF2 <---------AHL12(2)  <---------------AtSPL8     <
ggtgaaagtagagaattaaaatcaattaagggtaacaaataaagttgtttatataaaatataaaatacatgattatatgtacaattcataatattagtat  23636400
               <---------AHL25(2)                                                  <---------ANAC46
               --------->AHL25(3)                                                --------->MYB52(1)
               <---------AHL12(1)                                           --------->ARR11(3)
               <---------AHL25(1)                                           <---------RVE1(2)
               --------->AHL25(1)                                           <---------GLK1(2)
               --------->AHL20(2)                                     <---------AHL20(2)
               <---------AHL20(2)                                     <---------AHL25(3)
               --------->AHL12(3)                                    --------->AHL25(1)       ------
               <---------AHL12(3)                                    <---------AHL12(3)      -------
               <---------AHL25(3)              <---------ARR11(3)    --------->AHL25(3)      <------
              --------->AHL12(2)               --------->ARR11(3)    <---------AHL25(1)      -------
              --------->AHL25(3)               --------->RVE1(2)     --------->AHL12(3)      -------
              <---------AHL25(2)              --------->CCA1(1)      --------->AHL20(2)      <------
              --------->AHL25(1)            --------->AHL12(3)       <---------AHL20(2)     <-------
              --------->AHL20(2)            --------->AHL20(3)       <---------AHL12(1) --------->KAN1
     --------->HSFB2a(2)  <---------ANAC55(1) --------->RVE1(1)      --------->AHL12(1) --------->YAB5
     <---------HSFB2a(2) <-------TEIL       <---------AHL20(3)      --------->AHL12(2) <---------KAN1
---------YAB1 <---------AHL12(3)        <---------KAN1         ----------->GT1  ----------->HVH21
atatgatactagaagaaaaaaatttaaatacgtatgacaccgagtataaatatctaatgcaaaatacagaaaataaatagatactgacggataattccgg  23636500
     <---------TOE1(3)             --------->ARR14(2)
     <---------TOE2(3)             <---------ARR14(2)
--->LBD16                          <---------ARR11(2)
-->ANAC46                       --------->HSFB2a(2)
---ANAC55(2)                <---------GATA12                                          <---------KAN1
-->HSFB2a(2)       <-----------GT1 --------->ARR11(2)                             <---------ANAC46
-->ANAC55(2) <---------TOE2(3)  <---------HSFB2a(2)                      --------->ANAC58
---HSFB2a(2)<-----------GT1--------->KAN1 --------->ZAT14                <---------ALFIN1
--LBD16    <-----------GT1---------->DOF2<---------MYB52(1)              --------->ANAC58
aacacatgaaggttttaacatttaacccataaatcccagaacccgttcagtatttgaatttagtttttttatggccacgctcgtttcgagtttgggcctg  23636600
          <-----------GT1                        <---------At4g35610
      <---------AHL20(2)               <---------AHL25(1)
      --------->AHL20(2)               <---------AHL20(2)
      --------->AHL20(3)               <---------AHL12(3)
      <---------AHL20(3)               --------->AHL20(2)
    --------->AHL12(2)             ----------->TBP
    --------->AHL12(3)             --------->AHL20(2)
    <---------AHL12(3)             --------->AHL12(3)
    <---------AHL12(2)           <-----------TBP --------->At4g35610
  <---------RVE1(1)            --------------->AGL15                --------->YAB1
  <---------CCA1(1)           ----------------->AGL3      --------->WOX13(2)
 <---------ARR11(3)     --------->YAB5 <---------AHL20(3) <---------WOX13(2)  --------->YAB1     ---
 <---------RVE1(2)    --------->RVE1(2)----------->TBP--------->ANAC55(2)--------->TOE1(3)   -------
gctggatatttttttacccacaacaaatctctacccatatatataaatgggcctctcacttaataagcccataataccctaacatcatggagttggaaga  23636700
                 <---------TOE1(3)                                                               <--
             <---------WOX13(2)                                                                  ---
          <-----------------AGL2                                                            <------ZmHOX2a(2)
          ------------>CBF                                                                 <--------
          ----------------->AGL1                                                           <--------
   <---------AHL20(2)                                                                      <--------
   <---------AHL12(3)      --------->ANAC55(2)              --------->ZAT2                 ---------
   <---------AHL25(1)      <---------ANAC58                 --------->At4g35610            ---------
   <---------AHL20(3)      <---------ANAC58           <---------ARR11(2)                   ---------
   --------->AHL20(2)     ------->TEIL <---------DOF5.7(1)  <---------ZAT2          <---------MYB46(3)
   ----------->TBP    <---------------AtSPL3       --------->ALFIN1                 --------->MYB111(2)
 <-----------TBP <---------TOE2(3)    <---------DOF5.7(1)   <---------At4g35610    <--------P------>ZmHOX2a(2)
-------->GT1 --------->WOX13(2)       <----------DOF2 --------->ARR11(2)          <---------MYB52(1)
-->DOF5.7(1)--------->WOX13(1) *TSS   <---------DAG2<---------MYB46(3)       ----------->RAV1(1)<---
gggtatataaatggccaattagggttttgtacgtgctctcactttttctctcaagtggttcggagctgtttctaagaaaacaacaggtagttcggatcgg  23636800
-------At4g35610                                                  --------->ATHB12
------>At4g35610                                           --------->At4g35610
-GATA12                                                    <---------At4g35610            ------>ZmHOX2a(1)
-ARR14(2)                                                  --------->ZAT2                --------->TOE1(3)
-ARR11(2)                                                  <---------ZAT2                --------->ANAC55(2)
>ARR14(2)                                             ----------->RAV1(2)   <---------GATA12
>ARR11(2)                         ------>ZmHOX2a(1)   <---------At4g35610   --------->GATA12
>GATA12                     <---------YAB5       <----------DOF2 <---------YAB5          --------->TOE2(3)
--------ARR10            <-------TEIL           <---------DOF5.7(1) <---------WOX13(1)   <---------ANAC55(2)
agctacgcttgcaaaactcaaaacatggttcgtcatcctctaatctctatctctttcttctgagcttagtgattgtttacatctagatagttccttaact  23636900
              <------MYB83                                                           <---------AHL20(2)
             <---------MYB46(3)                                                    <---------YAB1
            <---------ANAC46                                             <---------ANAC58
            <--------P                                          <---------RVE1(2) <---------AHL25(2)
           <---------MYB52(1)                                  --------->YAB5     --------->AHL25(2)
         <-----------RAV1(1)                                   --------->ATHB12   <---------AHL20(3)
        <---------ANAC46                                       --------->KAN1     --------->AHL20(2)
      --------->ARR14(2)                                     <---------WOX13(1)   --------->AHL20(3)
      <---------ARR11(2)                                   --------->ATHB12----------->GT1
      --------->ARR11(2)                                  <---------AHL20(2)    --------->ICU4     -
      <---------ARR14(2)       <---------ANAC46           <---------YAB1 <---------ANAC58         <-
cgactctcgtttctggtgggtttgtgttagagtgacttagagaatgggttttgttagcaatttgattgattcgataacttgtgaatattatatgcatcat  23637000
           --------->AGP1 <---------ARR11(3)
           <---------AGP1 --------->ARR11(3)
           <---------ARR11(2)                             --------->YAB1                         <--
           <---------RVE1(2)------>ZmHOX2a(2)             --------->YAB5                   ---------
          <---------CCA1(2)<------ZmHOX2a(2)             <---------YAB1                    <--------
         ----------->ARR10<---------AGP1<---------At4g35610 <---------YAB1                 ---------
       ===========================HOX2a_HOX2a            --------->ICU4                 --------->YAB1
       ------>ZmHOX2a(1)  <---------GATA12             --------->YAB5                 ------>ZmHOX2a(1)
       ============================HOX2a_HOX2a         <---------ICU4                --------->TOE1(3)
       =============HOX2a_HOX2a      <-----------HVH21--------->ICU4                 --------->TOE2(3)
      --------->TOE2(3)  <---------CCA1(2)      <---------TOE2(3) <-------TEIL   --------->GLK1(1)
<---------RVE1(2)--------->At4g35610<-----------RAV1(1)--------->YAB1            <---------GLK1(1)
-------->KAN1------>ZmHOX2a(2)      --------->ALFIN1  <---------YAB1          <---------YAB5  <-----
--------YAB1<------ZmHOX2a(2)     <---------KAN1--------->MYB59--------->CCA1(2)<---------GATA12 ---
ggtgattctccttagatctgagctcattagatctcaaatgtgtcgctgatttaggtcatgatgatgatatacatagcagtagagatttccttaataataa  23637100
          --------->AHL25(1)                                   ---------->DOF2
          --------->AHL12(3)                                   --------->KAN1
          <---------AHL20(2)                           --------->DOF5.7(1)                         <
-------ARR11(3)    <---------AHL20(2)               ----------->HVH21                             <-
>YAB5     --------->AHL20(2)                      <---------At4g35610                <---------WOX13(1)
-ICU4     <---------AHL25(1) --------->ANAC46     --------->At4g35610               <---------ANAC58
>YAB1  --------->TOE2(3) <-----------GT1       <---------HSFC1(2)          --------->ATHB12       <-
------GT1--------->AHL25(3)<-----------RAV1(2) --------->HSFC1(2)         <---------YAB5          --
------>ARR11(3)----------->GT1   --------->ALFIN1--------->GLK1(2)  ------->TEIL    <---------ANAC58
catctcttaacatttattttgttaaattttacaggcgaggggtttgaagaagcatctgaagaggcttaatgcgcctaagcattggatgcttgacaaactt  23637200
<- Previous    Next ->

AGI:  At5g58420.1   
Description:  40S ribosomal protein S4 (RPS4D). Identical to 40S ribosomal protein S4-3 (RPS4D) [Arabidopsis Thaliana] (GB:Q8VYK6;GB:Q944M1;GB:Q9FGI0); similar to 40S ribosomal protein S4 (RPS4B) [Arabidopsis thaliana] (TAIR:AT5G07090.1); similar to 40S ribosomal S4 protein [Glycine max] (GB:AAM93434.1); contains InterPro domain RNA-binding S4; (InterPro:IPR002942); contains InterPro domain Ribosomal protein S4e, N-terminal and RNA-binding (InterPro:IPR013844); contains InterPro domain Ribosomal protein S4e, N-terminal (InterPro:IPR013843); contains InterPro domain Ribosomal protein S4e, central (InterPro:IPR013845); contains InterPro domain KOW (InterPro:
Range:  from: 23636732    to: 23638320    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.