Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                         <---------CCA1(1)
      --------->LBD16                    <---------RVE1(1)                                     -----
    <---------LBD16          --------->MYB52(1)      <---------GLK1(1)                         -----
----ARR10               ----------->RAV1(1)          --------->GLK1(1)         --------->TOE2(3)
->ARR11(3)             <----------ID1   <---------ARR11(3)         --------->TOE2(3)           <----
--ARR11(3)            --------->ZAT18   <---------RVE1(2)       <---------ARR11(3)    --------->YAB1
->ARR11(2)           --------->ALFIN1   --------->ARR11(3)      --------->ARR11(3)---------->DOF2  <
--ARR14(2)   --------->RVE1(2)     ----------->RAV1(1)         --------->KAN1  --------->TOE1(3)   -
->ARR14(2) --------->DOF5.7(1)---------->DOF2       --------->GATA12 ----------->HVH21--------->YAB5
 
tcttctctctgggaaaaatccagagtgcgacaaaacagccacagatattttctcagatttcttcaaaaatccttgacattagccttaaatcacaacaata  23134400
                                        --------->bZIP60(2)
                                  ------->TEIL
        ----------->GT1 --------->DOF5.7(1)
       ----------->GT1  --------->AHL12(1)
---->ARR11(3)          <---------AHL25(1)         ------>MYB83                --------->KAN1
---->RVE1(2)           --------->AHL25(2)         ------>MYB46(1)            --------->ZAT14
-----ARR11(3)          --------->AHL20(2)         -------->P        ----------->HVH21
---------ANAC55(2)     --------->AHL12(3)        ------>ZmHOX2a(1) --------->At5g28300
---------->GT1         <---------AHL12(2)<-----------HVH21  --------->DOF5.7(1)              <------
 
tcatgtaaaatcggaaaaaaaaaaaaaaaaatcgatgaacgcgaagtcactcctaccacgagaaaaacgctgtgaaacggtttactccagtagtagtcaa  23134500
                                                                                                  <-
                                                                            --------->AHL25(3)    --
                                                                           --------->AHL20(2)     <-
                                                                           --------->AHL12(3)     --
                                                                           <---------AHL20(2)     <-
                                                                           <---------AHL12(3)     --
           <---------ANAC55(2)                                 --------->ZAT6               --------
           --------->ANAC55(2)                                ------>MYB83 --------->AHL25(3)     <-
           <------MYB83                                       ------>MYB46(1)              ---------
           <------MYB46(1)                                    -------->P   --------->AHL25(1)     <-
          <---------TOE2(3)                                 --------->AtMYB61 <---------WOX13(2)  --
          --------->MYB46(2)                               --------->MYB46(3) --------->WOX13(2) <--
          --------->MYB59                   =============================RAV<---------AHL20(2)   ---
       --------->WOX13(2)                   <-----------RAV1(2)<---------ALFIN1  --------->AHL20(2)
       <---------WOX13(2)           --------->YAB1      <----------ID1     <---------AHL25(2)    ---
   <-----------------AG  <----------ID1   ----------->RAV1(1)----------->RAV1(1) <---------AHL20(2)
<---------AHL12(1)  ---------->DOF2<---------KAN1   ---------->DOF2        --------->AHL25(2)  -----
---WRKY38(1)    --------->ZAT6   --------->YAB1<------ZmHOX2a(1)           <---------AHL25(1)  <----
 
caaaaattcaaattaggtaagactaaagaagacgaagaataagaacaacaggagacaaagcgaccaacactgcgaaattttaatttaaacaaaacagtaa  23134600
     <---------YAB1
    <---------AHL12(2)
    --------->AHL12(3)
    <---------AHL25(2)
    <---------AHL12(3)
    --------->AHL12(2)
    --------->AHL25(2)
   <---------AHL25(3)
  --------->AHL12(3)
  --------->AHL12(1)
  <---------AHL12(1)
  --------->AHL25(2)
  <---------AHL12(3)
 --------->AHL12(3)
 --------->AHL12(1)
 <---------AHL12(1)
 --------->AHL25(2)
 <---------AHL25(2)
 --------->AHL12(2)
 <---------AHL20(3)
 --------->AHL20(3)
--------AHL25(3)
------->AHL25(2)
--------AHL20(2)
------->AHL20(2)               --------->LBD16
--------AHL12(3)              --------->ANAC46           ----------->GT1
------->AHL12(3)           --------->GATA12       <-------GAMYB
->At5g28300                <---------GATA12      <---------MYB46(3)                              ---
--------AHL25(1)           --------->ARR14(2)    <------MYB83                                   ----
-->GT1--------->KAN1       <---------ARR14(2)    <---------DEAR3(2)                             ----
--------AHL25(2)          --------->KAN1         <------MYB46(1)                                <---
------->AHL25(1)          <---------GLK1(1)     <---------DREB2C(2)                             ----
-------AHL20(2)       --------->HSFB2a(2)       <---------DEAR3(1)                              <---
------>YAB1           <---------HSFB2a(2) <---------ANAC46                                  --------
------>AHL20(2)       --------->HSFC1(1)  <---------ANAC58                            <---------LBD16
---->WOX13(2)         <---------HSFC1(1)  <---------ANAC58  --------->KAN1           ----------->RAV1(2)
-----WOX13(2)    <----------DOF2 --------->KAN1<---------YAB5                   <---------ARR11(3)--
 
ttaaaatttttattcgtaagcttttctcgaaatccgaaactcgtttcgtagtcggttgaagagaaaatcgagacgagaaacaagttctacctggagagaa  23134700
      --------->KAN1
    <--------P
   <---------MYB52(1)                                                                            ---
  --------->LBD16                                                                                ---
<---------LBD16                                                                                  <--
------>KAN4(2)                        <------NtERF2                                              <--
----->HSFC1(2)                       ------>NtERF2                                              ----
----->KAN1   --------->LBD16         --------->LBD16                                            ----
------HSFC1(2)--------->LBD16       <---------LBD16                                             <---
----->HSFB2a(1)                     --------->LBD16                                             ----
------HSFB2a(1)                    <---------LBD16                ---------->DOF2        --------->ZAT18
--->GT1     <---------LBD16      --------->ANAC46      <---------DAG2*TSS                <---------ZAT18
------->GLK1(2)<------NtERF2    ------>ZmHOX2a(1)      <----------DOF2       <---------KAN1<--------
 
aattccggtaagttcgccggaaaatgtgactagtcctcgccgggaaactaatagaatgctttatctctctaaagtttgggataaaacagtagtgagcaaa  23134800
                                                                                                   <
                                                                                                   <
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
         ----------->GT1                                                                   ---------
         <---------ZAT6                                                                    ---------
        <---------TOE1(3)                                     --------->WOX13(2)           ---------
     ------>ZmHOX2a(2)                                        <---------WOX13(2)          <-------PIF5
    <------ZmHOX2a(2)                                         <------------CBF            ------->PIF5
    --------->CCA1(2)                                       <---------AHL20(2)            <-------PIF4
   <---------GATA12                                        --------->AHL25(3)             ------->MYC2
   <---------ARR11(3)                                     <---------AHL12(2)              ------->PIF4
   --------->ARR11(3)                                   --------->AHL20(3)                <-------MYC3
   <---------RVE1(2)                                    <---------AHL20(3)                ------->MYC3
   --------->GATA12                                     <---------AHL12(1)                <-------MYC2
   --------->AGP1                                       --------->AHL12(1)               --------->ANAC58
   <---------AGP1                <---------ARR11(3)    --------->AHL12(2)                --------->ANAC58
------>ARR11(3)                  --------->ARR11(3)    <---------AHL12(2)             <---------SPL7(1)
------>AHL20(1)             <---------AHL25(3)    ----------->GT1                    <-----------HVH21
-------AHL20(1)           <---------WOX13(2)    <---------ANAC46                  <---------ANAC58--
-------AHL25(3)        --------->AHL20(2)    --------->ARR14(2)                   <---------ANAC58--
----->AHL20(2)       ----------->GT1         --------->ARR11(2)                   --------->O2  <---
----->AHL25(1)       --------->ANAC58        <---------ARR11(2)   <---------ANAC46<---------O2  ----
--------TBP          --------->ANAC58        <---------ARR14(2)<---------YAB5     <---------bZIP60(2)
----->AHL12(3)     <--------P---------->DOF2<-------GAMYB --------->AHL12(2)      <---------ANAC46<-
-At4g35610       <---------ANAC55(2)      <---------DEAR3(1)<---------YAB1        <---------ANAC55(2)
 
tatatagatctagggttaataggtaagtaaataaaagttcttgggccggttatgggtaaatttttaattgtttggaaactaaactacgtggcacgcgcta  23134900
                                                 --------->ARR11(3)
                                                 --------->RVE1(2)                                --
---------AHL20(2)                                <---------ARR11(3)                               <-
---------AHL25(3)                                --------->GLK1(2)                                <-
--------AHL20(3)                                --------->RVE1(1)                                 <-
------->AHL25(1)                               --------->AHL12(1)                                 --
--------AHL25(3)                               <---------AHL25(3)                                ---
--------AHL25(1)                              <---------AHL20(3)                                ----
>ANAC46                                       --------->AHL20(2)                                <---
>ANAC58    <---------bZIP60(1)                <---------AHL25(1)                               -----
>ANAC58   <------NtERF2                       --------->AHL12(3)                               <----
------->AHL20(2)                              --------->AHL20(3)                               -----
------->AHL25(3)                 --------->KAN1<---------AHL12(1)                              -----
------WOX13(2)          <---------DOF5.7(1)--------->AHL20(2)   ----------->GT1                <----
----->WOX13(2)         <----------DOF2    --------->AHL20(2)    <---------ZAT6                 <----
--------AHL20(2)   <-----------GT1    <---------YAB1      <---------YAB1         <---------AHL12(2)<
 
attaaatgctggtggcatcaaatttcctttttagttttattctcattaaaaaaatctgtggattattgtgttaaaaaaaaaaaaaaaaaactgtggatta  23135000
     <---------WOX13(2)
     --------->WOX13(2)
    <---------TOE2(3)
 <---------AHL20(2)
------->AHL20(3)
--------AHL20(3)
--------AHL20(2)
--------AHL25(2)
------->AHL25(2)                                                                                 <--
------>AHL12(1)                                                                                  <--
----->AHL25(3)                                                                                   ---
------YAB1                                                                                       ---
---->AHL25(2)                                                                                    <--
-----AHL20(3)                             <---------AHL12(2)                                     <--
---->AHL20(3)                       ----------->GT1                                              ---
---->AHL12(2)               ---------->DOF2                                         --------->AHL12(3)
-----AHL25(2)            --------->MYB46(3)  --------->MYB52(1)     ---------->DOF2 --------->AHL12(2)
-----AHL12(2)   <---------KAN1      <----------ID1      --------->DOF5.7(1)  --------->TOE2(3)  ----
---------YAB1  --------->GATA12   ---------->DOF2     ---------->DOF2    <----------DOF2 <----------
 
ttattttaagttaaatggaatctatctaaccaaaagaaaaagaaaaaaaaacagaagtaaagaaggttagcaaaagctttccttcatattttttaccaat  23135100
                                                                                            <-------
                        <---------AHL12(2)                                                  --------
                       --------->AHL20(2)                                                   --------
                       <---------AHL25(3)                                                   --------
                       <---------AHL20(2)                                                   <-------
                      --------->AHL25(3)                                                    --------
                      --------->AHL20(2)                                                    <-------
                     --------->AHL12(2)                                                     --------
                     <---------AHL12(2)                                                    <--------
                   --------->AHL12(3)                                                      ---------
                   <---------AHL20(2)                                                      <--------
                   <---------AHL12(1)                                                    <---------AHL25(2)
                   --------->AHL12(1)                                                    <---------AHL12(2)
                   <---------AHL12(3)                                                    --------->AHL20(3)
                   --------->AHL25(1)                                                    --------->AHL25(2)
                   --------->AHL25(3)                                                    <---------AHL12(3)
                   --------->AHL20(2)                                                    <---------AHL20(3)
                   <---------AHL25(3)                                                   <---------ICU4
                   <---------AHL25(1)                                             <---------ANAC55(2)
                   --------->AHL25(2)                         <-----------HVH21   ----------->GT1
                  <---------AHL12(1)                    <---------AHL25(3)      --------->AHL20(2)
                  --------->AHL12(1)                    <---------AHL25(2)      --------->AHL12(1)
              --------->AHL25(1)                        --------->AHL25(2)      <---------AHL20(2)
              <---------AHL20(3)                       <---------AHL12(3)       <---------AHL12(1)
              <---------AHL25(1)                       <---------AHL25(1)     <---------WOX13(2)
              <---------AHL20(2)                     <---------AHL12(3)       <---------AHL12(2)
              --------->AHL20(2)                     --------->AHL20(3)       --------->WOX13(2)
              <---------AHL25(3)                <---------AHL20(2)           <--------ATHB1<--------
              --------->AHL25(3)               --------->AHL12(3)            --------->ATHB51<------
              <---------AHL12(3)               <---------AHL12(3)            <--------HAHB4---------
  <---------ICU4  <---------AHL20(1)           <---------AHL20(3)            -------->HAHB4<--------
  --------->YAB1  --------->AHL12(3)           --------->AHL25(1)            <---------AHL25(3)
 <---------ATHB12 <---------AHL20(2)           --------->AHL20(3)            <---------ICU4---------
-------AHL20(2)   --------->AHL25(1)           --------->AHL25(2)            --------->YAB5---------
-------AHL25(1)   --------->AHL20(2)           --------->AHL20(2)            --------->YAB1---------
------>AHL25(1)   --------->AHL25(2)          --------->AHL12(2)            <---------YAB1 <--------
------>AHL12(3)   --------->AHL25(3)         --------->AHL12(1)             --------->AHL25(3)   <--
-------AHL25(3)   <---------AHL25(2)         <---------AHL12(1)             --------->ICU4 ---------
-------AHL12(3)   <---------AHL25(1) <------ZmHOX2a(1) --------->AHL20(2)   --------->AHL20(2)   ---
------>AHL20(2)  --------->AHL12(2)<---------TOE1(3) <---------AHL20(3)     <---------ATHB51<-------
----->AHL20(2)--------->AHL12(3)   <---------TOE2(3) --------->AHL12(3)     <---------ATHB12<-------
-GT1--------------->AtSPL8   <---------------AGL15 <---------YAB1 <---------CCA1(2)    --------->ICU4
 
ttaaatcatggtactatttaaattatttaataacatttaaggaactgaaattttataaatatatgtgtcatatcatctaataattaagtaaaaattatat  23135200
    ----------->GT1
 --------->DOF5.7(1)
--------->AHL20(2)
<---------AHL20(3)
<---------AHL25(1)
--------->AHL20(3)
<---------AHL20(2)
--AHL20(3)
->AHL20(3)
->AHL25(2)
->AHL20(1)
--AHL20(1)
->AHL25(1)           --------->YAB5
--AHL20(2)           --------->YAB1
->AHL20(2)       <---------ARR11(3)
-AHL25(1)        --------->ARR11(3)
>AHL25(1)        --------->AHL25(2)                       <---------MYB46(3)
-AHL12(3)        <---------AHL12(1)                      --------->ALFIN1
-AHL25(3)        --------->AHL12(1)                      <---------AtMYB61
---YAB1          --------->AHL20(1)                  <---------ZAT14
>AHL25(3)        <---------AHL25(3)                  --------->ZAT14                              --
-AHL20(2)        <---------AHL20(1)             <---------ANAC55(1)                              ---
>AHL20(2)       <---------AHL12(2)              <---------ANAC58                                 <--
>AHL12(3)       --------->AHL25(1)              --------->ANAC55(2)                            <----
>YAB1--------->YAB1 <---------YAB1              <---------ANAC46                           <--------
-AHL12(1)       <---------AHL12(3)              <---------ANAC58                       --------->ANAC55(2)
-------AHL20(2) --------->AHL12(2)              <---------ANAC55(2)                    <---------ANAC55(2)
>AHL12(1)<---------WOX13(2)                  <---------SPL7(1)           <---------ANAC55(2)<-------
------>AHL20(2) <---------AHL25(1)          <---------ANAC58<---------ANAC46    <---------ANAC55(2)
--AHL25(2)      --------->AHL12(3)          <---------ANAC58--------->ALFIN1    --------->ANAC55(2)<
--AHL25(3) ----------->GT1         ---------->DOF2 --------->REM1(2)     --------->ANAC55(2)<-------
 
taaaaaaatgaaaattgaaatatatcataacattgaataaaagtttggcttacgtgtacagtggtggagtcacattaagtattatgtattatgtattatt  23135300
<- Previous    Next ->

AGI:  At5g57110.1   
Description:  ACA8 (AUTOINHIBITED CA2+ -ATPASE, ISOFORM 8); calcium-transporting ATPase/ calmodulin binding. Identical to Calcium-transporting ATPase 8, plasma membrane-type (ACA8) [Arabidopsis Thaliana] (GB:Q9LF79;GB:Q9LU75); similar to ACA10 (autoinhibited Ca2+ -ATPase 10), calcium-transporting ATPase/ calmodulin binding [Arabidopsis thaliana] (TAIR:AT4G29900.1); similar to calcium-transporting ATPase, plasma membrane-type, putative / Ca(2+)-ATPase, putative (ACA13) [Arabidopsis thaliana] (TAIR:AT3G22910.1); similar to ACA9 (autoinhibited Ca2+ -ATPase 9), calcium-transporting ATPase/ calmodulin binding [Arabidopsis thaliana] (TAIR:AT3G21180.1); similar
Range:  from: 23126664    to: 23134770    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.