Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                           ---------
                                                                                         <---------MYB52(1)
                                                                                       --------->TGA1a
                                                                                       <---------O2
                                                                                       ----------->GT1
                     ----------->HVH21                                                 --------->O2
                     ----------->TGA1                                 <---------ZAT6   --------->ANAC46
                   <---------ICU4                              ==================================bZIP_DOF
           --------->TOE2(3)                              <---------MYB52(2)           --------->ANAC58
          <---------ICU4                                 --------->ANAC58              --------->bZIP60(2)
          --------->YAB5        <<<<<<<<<<<<<<<<<LFY     ----------->GT1               --------->ANAC58
          --------->ATHB12  <---------WOX13(2)           <---------ANAC55(2)           =============
          --------->YAB1--------->ANAC58                 --------->ANAC46              <---------TGA1a
          <--------HAHB4<---------ANAC55(2)              --------->ANAC55(1)           <---------ANAC55(2)
         <---------YAB1 --------->ANAC58<---------ZAT6   --------->ANAC58              --------->ANAC55(2)
         <---------YAB5 --------->ANAC46----------->GT1  --------->ANAC55(2)      ----------->HVH21
--->YAB1 --------->ICU4 --------->ANAC55(2)  <---------WOX13(2)---------->DOF2 --------->RVE1(2)
--TOE2(3)<---------ATHB12   --------->WOX13(2)    <------ZmHOX2a(1) ----------->GT1    --------->ANAC55(1)
 
aaactgagagtaatcattaaactcatgacgcaattacacaatggtgttatttaggacaacaagtaacaaagtagtgaaacaatgtctgacacgttacttg  20320200
                                                                                               -----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                          ----------
                                                                                          --------->YAB5
                    <---------ANAC58                                                  --------->DAG2
                    <---------ANAC58                                                 <---------ZAT14
                  <---------YAB1                                                     --------->ZAT14
      <----------DOF2   <---------RVE1(2)                                       --------->ICU4<-----
--ANAC58        <---------ICU4                              --------->ATHB12   --------->WOX13(2)
--ANAC58       <---------YAB1                          --------->AtLEC2      --------->AHL20(2)<----
--ANAC55(1)    <---------YAB5               <---------ARR11(3)      <---------DOF5.7(1)----------->GT1
--ANAC46     --------->YAB1           --------->YAB1 <---------ANAC58        <---------AHL20(2)<----
>MYB52(2)   <---------YAB5      ------->TEIL--------->ARR11(3)    ------->TEIL <---------WOX13(2)  -
=================bZIP_DOF      <---------TCP16(2)    <---------ANAC58<----------DOF2 ---------->DOF2
 
tgtttgcaactttgcatcatcatgcttgatatgtggacctattagaagaacttgggccttgcacgattgcatctttgtttttaattagtaaagtgattaa  20320300
          --------->WOX13(1)
        <---------ATHB12
  --------->ANAC46
  --------->ANAC58
  --------->ANAC58
---->WOX13(2)        ------>ZmHOX2a(1)
-->AHL25(3)         --------->TOE2(3)                                <---------MYB52(2)
---AHL25(1)  <---------AHL20(2)             <----------DOF2        --------->MYB52(1)
---AHL20(2)  --------->AHL25(1)       --------->O2              --------->ANAC46
-->AHL25(1)--------->WOX13(2)       <---------DDF1              --------->ANAC55(2)
-->AHL20(2)<---------WOX13(2)       >>>>>>>>>>DREB2A            <---------ANAC55(2)   <-------MYC3
->GT1  --------->RVE1(2)            <---------RAP2.6(3)         --------->ANAC58      ------->MYC3 <
----AHL20(2)<---------ATHB12        >>>>>>>>>>DREB1A            --------->ANAC58     <---------TGA1a
-----WOX13(2)--------->AHL20(2)   --------->DEAR3(2)       --------->YAB1            --------->TGA1a
-----AHL12(2)--------->AHL25(3)  --------->MYB52(1)      --------->ANAC58            ===============
-------->DOF5.7(1)  --------->TOE1(3) <---------O2       --------->ANAC58--------->ZAT6      -------
 
ataagacgcaaatcaattaatgtccttaacaaaacataccgacatgactttgaatagagcaagcatcacgaaacgaactctattccaaacgtgtgtttga  20320400
                             <---------AHL20(2)
                             <---------AHL25(1)
                             <---------AHL12(3)
                             --------->AHL25(2)
                            <---------AHL25(2)
                            --------->AHL25(3)
                            <---------AHL12(1)
                            --------->AHL25(2)
                            --------->AHL12(1)
                            <---------AHL25(3)
                            <---------AHL25(1)
                            --------->AHL25(1)
                            --------->AHL12(3)
              <---------GLK1(1)
             <---------GATA12<---------AHL25(3)
             --------->GATA12<---------AHL25(2)
       <----------DOF2      <---------AHL20(2)
      <---------ANAC58      --------->AHL20(2)
      <---------ANAC58      <---------AHL12(3)
  <---------ANAC58   --------->ARR11(2)                                                   <---------
  <---------ANAC58   <---------ARR11(2)                                                   <---------KAN1
---------GLK1(2) <---------LBD16                               --------->ATHB12<---------AHL20(2)
==================bZIP_DOF --------->AHL25(3)                 <---------YAB1 --------->AHL12(2)
---->HVH21   ------->TEIL  <---------KAN1              <---------YAB5     <---------ARR11(3)--------
 
cagtttcttgcttttgaatctccggttcgaattaatttgtgtttgaaccgtgttccgaatggtttatgatgggccaagttattttatatgagaatgttgg  20320500
                             <---------AHL25(3)
                            <---------AHL20(2)
                            --------->AHL20(2)
                            <---------AHL25(1)
                            --------->AHL25(1)
                           --------->AHL12(2)
                           <---------AHL12(2)
                      --------->YAB1
                      --------->AHL20(2)
                     <---------YAB1
                     --------->ICU4
                     <---------YAB5                                      --------->HSFB2a(2)
                    <---------AHL20(3)                                   --------->HSFC1(1)
                    --------->AHL20(3)                                   <---------HSFB2a(2)
                    --------->AHL25(2)                           --------->MYB46(3)
                    <---------AHL12(2)                           <---------ATHB12
                    <---------AHL12(3)                          ------>MYB83  --------->HSFC1(2)
                    --------->AHL12(2)                          -------->P    <---------HSFC1(2)
                   --------->YAB1                               ------>MYB46(1)
                   <---------AHL25(3)                          --------->MYB55(1)
                  --------->AHL20(2)                          --------->AtMYB61
                  <---------ATHB51                            <---------MYB111(2)
                  <---------ATHB12                            --------->MYB46(3)
                  --------->AHL25(1)                          <---------MYB46(2)
                  <---------AHL25(1)                          --------->DEAR3(1)
       --------->ANAC46 <---------YAB1                        <---------MYB111(1)  <---------ALFIN1
   --------->KAN1 <---------AHL20(2)                          <---------MYB55(2) ------>MYB46(1)
   --------->YAB1 --------->ICU4                             --------->MYB46(3)  ------>MYB83
  <---------ATHB51--------->AHL25(3)                       <---------ALFIN1   <---------HSFB2a(1)
 --------->WOX13(2)<---------ICU4          --------->DAG2  --------->AtMYB61  --------->HSFB2a(1)  <
 <---------WOX13(2)--------->YAB5    <---------GATA12     --------->MYB46(3)<<<<<<<ZML2            -
--RAV1(1)         <---------AHL12(1) --------->GATA12<-----------GT1    XXXXXXXXXXXXXXXXXXXX>MIR3440B-5P
->ALFIN1          --------->AHL12(1) --------->RVE1(2) --------->MYB46(3)<---------HSFC1(1) --------
 
gctcaattatacgaagcccaaataattataaataaatgcaaatcgaaaggtatatgttaccaccaccaaccattttctagaaccttccacttcttcttac  20320600
                                                               <---------TOE2(2)
                                                               <---------TOE1(2)
                                                               <---------TOE2(3)
                                                             --------------------->WRI1
                                                           >>>>>>>>>MYB98
                                                          ------>MYB83
                                                        <---------MYB111(1)
                                                        <---------MYB59
                                                        <---------MYB111(2)
                                                        <---------MYB46(2)
                                                      ------->TEIL                       <---------ATHB12
        --------------------->WRI1                 <---------At4g35610                   --------->MYB46(3)
<---------ANAC58                       *TSS  <<<<<<<<<TBF1------>MYB46(1)               ------>MYB46(1)
<---------ANAC58                  <---------CCA1(2)--------->At4g35610   --------->WOX13(1)    <----
---------At4g35610        --------------------->WRI1  -------->P      <-----------GT1   -------->P
-------->At4g35610        <------------------------ANAC81 --------->MYB52(1)--------->RVE1(2)  <----
------------->WRI1     ------>ZmHOX2a(1)  <<<<<<<<<TBF1--------->ANAC46<---------YAB1   ------>MYB83
 
ttagcttcccacatagttttcttctccttccttcttcttatcttcttcttcttcatctacctaacttaggttttatcaatctctcatttccaaccatggc  20320700
       <------NtERF2
      --------->ABI4(1)
      ------>NtERF2
      --------->ORA47(1)
     --------->RAP2.3(2)
     --------->RAP2.6(2)
     --------->ATERF1(2)
     --------->RAP2.3(3)
     --------->RRTF1(3)
     --------->DREB2C(2)
     --------->RRTF1(2)
     <---------ATERF1(2)            --------->GLK1(1)
     --------->DEAR3(1)             <---------GLK1(1)
    --------->ORA47(2)             <---------ARR11(2)
    --------->ERF1                 --------->ARR11(2)
    --------->DEAR4(2)             <---------ARR14(2)
    --------->ATERF1(1)            <---------GLK1(2)
    --------->RRTF1(1)       <---------ARR14(2)
    --------->RAP2.3(1)      --------->ARR11(2)
   <---------ATERF1(1)       --------->ARR14(2)
   --------->At4g35610       <---------ARR11(2)
   ------>NtERF2            <------NtERF2
   --------->LBD16       <------NtERF2
   <---------At4g35610   --------->At4g35610
   --------->ABI4(1)     <---------LBD16
  --------->DEAR3(1)   <---------DEAR3(1)
  --------->ANAC46    <---------LBD16            <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
  <---------ALFIN1    ------>ZmHOX2a(1)         ---------->ID1   --------->AtMYB61
------>ZmHOX2a(1) --------->GATA12 --------->ARR14(2)          ----------->RAV1(1)
-----ANAC58      --------->KAN1    --------->GATA12         ------>ZmHOX2a(1)
-----ANAC58    <-----------GT1     <---------GATA12      ------>ZmHOX2a(1)    ----------->RAV1(1)  -
 
ttcctccgccgcccaaattcacatcctcggcggaatcggattccctacttcgtcttcttcctcctccaccaaaaacctcgacaacaaaaccaattccatt  20320800
                                                    <---------DOF5.7(1)
                                                  --------->LBD16
                                                  ------>NtERF2                                    <
                                              --------->AtMYB61                            <--------
                    ------->GAMYB            <---------MYB55(2)                            <--------
                  --------->At4g35610        --------->MYB46(3)                            ---------
              --------->HSFB2a(2)           -------->P                                     ---------
       <---------DOF5.7(1)        --------->ZAT6 <---------ALFIN1                        --------->ANAC46
   <---------HSFC1(2)          ------>ZmHOX2a(1) --------->DEAR3(1)                      --------->LBD16
   --------->HSFC1(2)          <----------DOF2------->GAMYB      <----------ID1         <---------HSFB2a(2)
   --------->HSFB2a(1)  <---------KAN1      ------>MYB46(1) <---------SPL7(1)           --------->HSFB2a(2)
-------->ANAC46  ----------->RAV1(1)        ------>MYB83 --------------->AGL15 --------->MYB46(3) <-
 
ccacgaagcgtcttcttcggcaacagaacaagtcctttcactactccaacctccgccttccttcgtatgggacgaagaaacaacaacgcttcccgataca  20320900
                                                                                                <---
                                                                                             -------
 <------MYB46(1)<-------GAMYB                                                               <-------
 <---------MYB46(3)                                                                         --------
 <------MYB83  <---------MYB46(3)                                                          ------>MYB83
 <---------DEAR3(2)      ---------->DOF2                       <-----------RAV1(1)         ------>MYB46(1)
<---------AtMYB61  <---------DOF5.7(2)                         <---------MYB46(3)         --------->MYB52(1)
---------MYB52(1)--------->DOF5.7(2)                         <---------ZAT2    --------->DOF5.7(1)
-ARR14(2)   --------->ALFIN1                      --------->ANAC58  <---------ANAC46     --------->TOE1(2)
-ARR11(2) <---------ANAC58                        --------->ANAC58 <---------At4g35610   --------->TOE2(2)
>ARR14(2) <---------ANAC46          <---------ARR11(2)       <---------At4g35610        --------->MYB46(3)
>ARR11(2) <---------ANAC58          --------->ARR11(2)       --------->At4g35610  ----------->GT1
------GAMYB <---------MYB52(1)  <------NtERF2--------->MYB59 ----------->RAV1(2)<------ZmHOX2a(1)
 
ccgttggtccagtccgtgtggttaacgagaaagtcgtcggaatcgatttaggcacgacgaattcagctgttgctgctatggaaggaggtaaaccaacgat  20321000
                                        <---------ANAC46
                                        <---------ANAC58
    <---------TOE2(3)                <---------RAP2.6(2)
   --------->MYB52(1)    --------->REM1(1)                           <------MYB83
 <---------MYB52(2)      <---------ALFIN1                            <---------MYB46(3)
------KAN1          --------->ARR11(3)  <---------ANAC58           <--------P
-->YAB5         ---------->DOF2  <-------GAMYB          --------->DOF5.7(1)                    <----
--ATHB12       <---------WRKY12 <-----------RAV1(1)     <---------YAB5      <---------WOX13(1) -----
->MYB46(3)     <---------WRKY38(1) <-----------RAV1(1)---------->DOF2<------MYB46(1)--------->ANAC46
 
tgtgactaacgctgaaggtcaaagaactacaccttctgttgtggcttatactaagagtaaagatagacttgttggtcagattgctaaacgtcaagctgtt  20321100
<- Previous    Next ->

AGI:  At5g49910.1   
Description:  cpHSC70-2 (HEAT SHOCK PROTEIN 70-7); ATP binding / unfolded protein binding. similar to MTHSC70-1 (mitochondrial heat shock protein 70-1), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT4G37910.1); similar to mtHSC70-2 (HEAT SHOCK PROTEIN 70), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT5G09590.1); similar to CPHSC70-1 (chloroplast heat shock protein 70-1), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT4G24280.1); similar to heat shock protein 70 [Cucumis sativus] (GB:CAA52149.1); similar to heat shock 70 protein [Spinacia oleracea] (GB:AAB91471.1); similar to chloroplas
Range:  from: 20320640    to: 20323695    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.