Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                           --------->ARR14(2)               <---------DOF5.7(1)
                                       <---------MYB52(1)                   <----------DOF2
                                      <-----------HVH21                    <---------DAG2
-->ZmHOX2a(2)                       <-------TEIL  --------->At4g35610   <-----------GT1
--ZmHOX2a(2)                      --------->ARR11(2)                  <----------DOF2
--->ARR11(3)                      <---------GLK1(2)                  <---------DOF5.7(1)
----GATA12                        --------->ARR14(2)            --------->MYB46(3)
----ARR11(3)                      <---------ARR11(2)          <-----------GT1    <----------DOF2
>GAMYB                            <---------ARR14(2)       ----------->GT1 <---------DOF5.7(1)     <
cttggtgtctggagattaaacgaagacgtttcactccgattcgtcagttctggagctgagttttgtaacaactctttaccttttcttttgttcttgttgt  19137700
          <----------DOF2                                            <---------AHL20(2)
         <---------ANAC58                                            --------->AHL20(2)
         <---------ANAC58                                            <---------AHL25(2)
      <---------MYB52(1)                                             <---------AHL20(3)
     <-------GAMYB                                                   <---------AHL25(1)
    <-----------RAV1(1)   <---------RVE1(2)                    ----------->GT1
<----------DOF2          --------->ATHB12                     ----------->GT1---------->DOF2
---------DOF5.7(1)    <----------DOF2                   ---------->DOF2<---------AHL12(1)        <--
tgtctttctgttgctttctgggtttctttgatttgaacaagaacagacagttcatgtcttaaagagagataaaaaaattctaaagaaaaccagtggaatt  19137800
                <---------AHL25(2)                       <----------DOF2
                <---------AHL25(1)                       <---------DAG2
               <---------AHL25(2)                       <---------ANAC58
               --------->AHL25(3)                       <---------ANAC58
               --------->AHL20(2)                  <---------AHL12(2)
               --------->AHL12(3)                 <---------AHL25(2)
               --------->AHL25(2)                 --------->AHL12(1)
               --------->AHL25(1)                 <---------AHL12(1)
               <---------AHL12(3)                --------->AHL25(3)                             <---
               <---------AHL25(1)       --------------->AtSPL8                                  ----
              --------->AHL12(2)        <---------------AtSPL8                               <------
-------YAB1   <---------AHL12(2)        <---------------AtSPL3                     ----------->GT1
ttgatggaaaacacaaaaattaattactttagttaaaccagaaaatgtactaaaaatttgctttttgggtttcttaagttctaaaattgagaaaatggaa  19137900
                                                                      <---------ARR11(3)           <
                                                                      --------->ARR11(3)           <
                                                                      <---------ARR11(2)          <-
                                                                      --------->ARR11(2)          <-
                                                                      <---------ARR14(2)          --
                                                                      --------->ARR14(2)          <-
                                                                      <---------AGP1             <--
                                                                      --------->RVE1(2)       ------
                                                                      --------->AGP1        --------
------KAN1                 --------->AHL12(2)                         --------->GATA12   --------->YAB1
----->MYB46(3)      ---------->DOF2                                   <---------GATA12 --------->WOX13(2)
----ID1       ----------->GT1               <---------RVE1(2)        <---------CCA1(2) <---------WOX13(2)
caaatgaaatttgtagagagaaataaagtttttttttttttgggttagattgtggaagaagagtatgaacacagatctatataacagcttaatgagaaag  19138000
--------RVE1(2)                                                                         ------------
--------GLK1(2)                         --------->ANAC58                                <----------DOF2
------->ARR11(3)                        --------->ANAC58                           <---------DAG2---
--------ARR11(3)                        --------->ANAC46                           <----------DOF2
-------RVE1(1)              ----------->RAV1(1)               <-----------GT1      <---------DOF5.7(1)
--->DOF5.7(1)      <------ZmHOX2a(1)  ---------->DOF2  <---------ZAT14    <----------DOF2     ------
-->DOF2------>ZmHOX2a(1) ------------------------>ANAC81 <---------ANAC46<---------DOF5.7(1)  <-----
agattttttcctggaaactgaaggagagagacaacaaaactaaaagccagagattgagtttagtataacaagtctctctttctctgcttttctttgtcga  19138100
        <---------TOE2(3)        <---------ANAC55(2)     ---------->DOF2
        --------->DOF5.7(1)   <---------MYB52(1)      <------ZmHOX2a(1)
        <---------YAB1       <-----------HVH21    --------->CCA1(2)
--->AGL15              --------->ANAC46  --------->TOE1(3)
------->DOF2      --------->DOF5.7(1)    --------->TOE2(3) --------->DOF5.7(1)
--->HSFB2a(2)   --------->DOF5.7(1)*TSS ----------------->AGL1
----HSFB2a(2)   ---------->DOF2  --------->bZIP60(1)--------->DOF5.7(1)                ---------->DOF2
gaaagcagattaagatggaaaaagacacaaaacgttacgccattccttaaaagataaggagaaagaagagaagaaatcgtgtttcaacacaaaagaaaac  19138200
               --------->ANAC58                                                   <------MYB83
               --------->ANAC58                                            --------->YAB1
              --------->SPL1(2)                                            <---------AHL25(3)
              --------->SPL7(1)                                            <---------ICU4
             --------->SPL1(1)                                             --------->ATHB51
             <---------SPL1(1)                                             <--------ATHB1
            <---------SPL1(2)                                              -------->HAHB4
            <---------SPL7(1)                                             <---------AHL20(2)
           <---------DEAR3(2)                                             <---------YAB5
           <---------ANAC58                                               --------->ICU4
           <---------ANAC58                                               <---------YAB1
          --------->SPL7(1)   ---------->DOF2                             <---------ATHB51
          --------------->AtSPL3                                         <---------AHL12(2)
         <------------------SPL14                                        --------->AHL12(2)
        ------------------>SPL14                                        --------->YAB1
       <---------ANAC58  ------->MYC3                      --------->HSFB2a(2)    <------MYB46(1)
       <---------ANAC58 --------->ANAC46  ---------->DOF2  <---------HSFB2a(2)   <---------TOE1(2)
agaagaaatcgcgtccgtacggattacacgttgaaaagtatgtgtgaaagactcatacatttctagactctgtattaataattgtaggtataaataactt  19138300
                                                                                 <-----------GT1  <-
                                                                             <----------DOF2  ------
                                                                            <---------ANAC58  ------
                                                                      <---------AHL20(2)      ------
                                                                      <---------AHL25(1)      <-----
                                                                      --------->AHL20(2)      <-----
                                                                      --------->AHL25(1)    <-------
                   ------->TEIL                                       <---------AHL25(3)    <-------
            <---------AHL20(2)                                       --------->AHL25(3)     --------
       --------->ICU4  <---------At5g28300                           <---------AHL20(2)     --------
       --------->AHL12(1)                                           --------->AHL12(2)      --------
       <---------KAN1 <-----------GT1   ------->TEIL            <---------DOF5.7(1)--------->ZAT6 --
       <---------AHL12(1)       --------->ZAT6           <-----------GT1    <---------ANAC58--------
atattgtggaatttttaaaatgaatttacagcctaagactatgtatattagtttgttttttaagcactcttatttatttgcttttaacactccatattat  19138400
---->AHL12(2)       <---------AHL12(1)
-----YAB1<-----------GT1                                            --------->AHL20(3)
-----AHL12(2)       --------->AHL12(1)                              <---------AHL12(2)
--->AHL12(2)        <---------AHL20(2)                              <---------AHL25(2)
----AHL20(1)        <---------AHL25(3)                              --------->AHL12(2)
----AHL20(2)        <---------ICU4                                  <---------AHL20(3)
--------AHL12(2)    -------->HAHB4                                  --------->AHL25(2)
--->AHL12(3)       <---------ATHB51         <---------TOE2(3)      --------->AHL20(2)
--->AHL20(3)       <---------YAB5          <-----------GT1         --------->YAB1              <----
--->AHL25(2)       <---------YAB1         <-----------GT1          --------->AHL12(3)        -------
----AHL25(2)       <---------ATHB12--------->AHL25(3)              <---------AHL25(2)        -------
----AHL20(3)       --------->ICU4  <---------AHL20(2)              <---------AHL12(3)        <------
--AHL20(2)        --------->AHL12(2)    <---------AHL12(2)         <---------AHL25(1)        <------
--AHL25(2)        --------->WOX13(2) --------->AHL12(2)            <---------AHL25(3)        <------
->AHL12(3)    --------->ZAT2       <---------AHL25(1)              --------->AHL20(3)  ------>MYB46(1)
->AHL25(1)    --------->At4g35610  --------->AHL25(1)              <---------AHL20(3)  ------>MYB83
->AHL25(3)    <---------ZAT2<---------ARR11(3)                  --------->AHL12(2)   ------->GAMYB
------->AHL12(2)  <---------WOX13(2)--------->AHL12(2)          --------->YAB1    <-----------GT1
->AHL25(2)    <---------At4g35610  --------->AHL20(2)          <---------AHL20(2)<-----------GT1
tttttattttttttcccagctaattattcaacatctgtttaatttttaacatttacaatggtttgtttaataatattcaacattttaacccactattttt  19138500
                                              <---------AHL25(2) --------->YAB1
                                              --------->AHL25(2) --------->AHL20(2)
                                  --------->ZAT6<---------AHL12(2)  --------->AHL20(2)
    --------->AHL12(3)       --------->YAB1  --------->AHL25(1)--------->AHL12(2)
    --------->AHL12(2)     --------->AHL20(2)--------->AHL12(3)<---------AHL12(2)               ----
-------GT1                 --------->AHL20(3)--------->AHL25(3)--------->AHL25(2)              <----
-->AHL12(3)            --------->ANAC55(2)   --------->AHL20(2)--------->AHL20(3)              -----
-->AHL20(3)            <---------ANAC55(2)   <---------AHL20(2)<---------AHL20(3)         <-------GAMYB
---AHL20(2)          <-----------GT1<---------ANAC55(2)    --------->YAB1                <---------MYB46(3)
---AHL20(3)          --------->AHL20(2)--------->RVE1(2) --------->AHL20(2)              --------->MYB52(2)
---AHL25(1)<---------YAB1  <---------AHL20(3)<---------AHL25(1)<---------AHL12(3)    <---------YAB1
atctcatattttttatgtttcaaattacatattaataacacttatcaaataaatttaagttaaaataattataaaatacaaacaaattatgtttgttgaa  19138600
<- Previous    Next ->

AGI:  At5g47070.1   
Description:  protein kinase, putative. similar to protein kinase, putative [Arabidopsis thaliana] (TAIR:AT4G17660.1); similar to protein kinase, putative [Brassica oleracea] (GB:ABD65030.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009)
Range:  from: 19135770    to: 19138136    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.