Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                     <---------AHL12(3)                              <---------AHL20(2)
                    --------->YAB1                                 <---------AHL12(2)
                   <---------YAB1                                  <---------WOX13(2)
               <---------AHL12(2)                                <---------AHL12(3)
               <---------AHL25(2)                                --------->AHL12(1)
               --------->AHL20(3)                                <---------AHL12(1)
               --------->AHL20(1)                                <---------AHL25(3)
               --------->AHL25(2)                                <---------AHL25(1)
               <---------AHL12(3)                                --------->AHL25(1)
               --------->AHL20(2)                                <---------AHL20(2)
             --------->AHL20(1)                                  --------->ATHB51
             --------->AHL12(1)                                  --------->AHL20(2)
             <---------ARR11(3)                                 --------->AHL25(3)
             <---------AHL12(1)                                 <---------YAB5
             <---------AHL20(1)                                 --------->AHL12(1)
             --------->AHL20(2)                                --------->AHL12(2)
             <---------AHL25(2)                                <---------AHL12(2)
             --------->AHL25(3)                               <---------ICU4
-------->GLK1(1) --------->YAB1                       <---------RVE1(1)
---------GLK1(1)<---------YAB1           <---------ARR11(3) <---------TOE2(3)
------->GATA12 <---------AHL20(3)    --------->YAB1  <---------ARR11(3)
-->RVE1(2)   --------->AHL25(2)    --------->RVE1(2) <---------GLK1(2)
>AHL12(1)    <---------AHL20(3)  <---------YAB1      --------->ARR11(3)---------->DOF2             <
-AHL12(1)    --------->AHL20(3)<-----------GT1<---------AHL20(2)<---------AHL12(1)      <---------AHL12(2)
agatttctctagtcaaaatattataaaaattaaattactatcaacatattttaaaagatttttaagaattatttaaaagctattgacaaaaaaaaaacat  16387200
                                    <---------ANAC46               --------->YAB1
                                    <---------ANAC58              <---------YAB1                   -
                            --------->LBD16                       <---------YAB5              ------
                           --------->HSFC1(1)                    <-----------GT1       ----------->GT1
     ----------->GT1       <---------HSFC1(1)<-----------GT1    --------->YAB1       ---------->DOF2
  ---------->DOF2          <---------HSFB2a(2)               <----------DOF2   --------->YAB1-------
---------AHL20(2)          --------->HSFB2a(2)    --------->MYB52(1)     <-----------GT1    --------
attttaaaagataaaacaaatttcatatttccagaaaatgcttgtaaataacttaactgcatttcttttatcattttcacattcaaaacaaagtaaaaag  16387300
                                                                <---------DOF5.7(2)            -----
                                                               <---------WRKY38(1)             -----
                                                         -------->HAHB4                        -----
                                                         --------->YAB1                        <----
      --------->ICU4                        ----------->GT1    <---------WRKY12                -----
   --------->AHL20(2)                     <---------ARR11(3)   <---------WRKY45              <------
 ----------->GT1                    <---------TOE2(3)   <---------YAB1                     ------>NtERF2
--------->DAG2                    ---------->DOF2     --------->YAB1                       <--------
--------->DOF2      --------->RVE1(2)     --------->ARR11(3)  <<<<<<<<<WRKY6              --------->RAP2.6(2)
----->GT1    --------->AtMYB61   <---------ATHB12    --------------->AGL15               <---------RAP2.6(2)
-->DAG2<-----------GT1          <---------WOX13(2)   <---------------AGL15------->TEIL  <---------At4g35610
-->DOF2<---------ICU4           --------->WOX13(2)<-----------GT1<---------TOE1(3)  <---------KAN1
taaaaagtaattactaccaaaacaatctaagtttcaataaaggaagatagtatttactaataatagtcaacgttatggacttgttgaatatagcggccac  16387400
   <-----------RAV1(2)                                                         --------->TGA1a
--------HVH21                                                                  <---------ANAC46
---->ANAC58                                                                    <---------TGA1a
-----O2                                                                        --------->PIF3(3) ---
---->O2                            ----------->GT1  <---------ANAC46           <---------PIF3(3)<---
---->ANAC46                  ------>MYB46(1)  --------->ANAC46               <---------ALFIN1  <----
---->ANAC58                  ------>MYB83     --------->ANAC58          <---------KAN1        ------
---->TGA1a                 --------->AtMYB61--------->MYB52(1)      --------->LBD16       --------->ATHB12
-----TGA1a           --------->ANAC58      --------->TOE1(2)       --------->HSFB2a(2)--------->YAB5
---->bZIP60(2)       --------->ANAC58     --------->MYB46(3) <-----------GT1---------------->PIF3(2)
---ALFIN1            --------->ANAC46     <---------MYB52(2)<---------AHL20(2) --------->O2   <-----
---HVH21----------->GT1  <--------------OsCBT --------->ANAC58    <---------LBD16--------->ALFIN1<--
gtcgtctcagaaggcaaaaacagcacgagaccaacgcgaagtgaaacaaacgacatcgtgtattttatctcccgaatgagccacgtggatgactgagtgg  16387500
                      <---------ALFIN1                     ------>NtERF2
                    --------->ANAC46                       <---------ATERF1(1)
                   --------->MYB46(3)                     <---------ATERF1(2)    <---------ANAC58
                  --------->TCP15(2)                      --------->ATERF1(2)    <---------ANAC58
      --------->ARR11(3)                                  --------->RAP2.6(2)<---------ANAC58
      <---------ARR14(2)                                  --------->DEAR3(1) <---------ANAC46
      --------->ARR14(2)                                 --------->ATERF1(1) <---------ANAC58
      --------->RVE1(2)                                  --------->SPL7(1)  <-----------------------TaNAC69(2)
      <---------ARR14(3)                               <---------SPL7(1)   ------->GAMYB
      --------->ARR14(3)                             --------->At4g35610 <---------At4g35610
      <---------ARR11(3)                           --------->YAB1 --------->ARR14(2)
 ------------>CBF --------->TCP23                  --------->ATHB12      --------->At4g35610   *TSS
------>PCF2      <---------TCP20                  <---------ATHB12--------->ARR14(3)       <--------
------PCF2       --------->PCF2                   <---------KAN1  <---------ARR14(3)       <--------
-----ATERF1(1)   <---------TCP15(1)           --------->ANAC58    --------->ARR11(3)       <--------
--->ZAT18       <---------PCF2                --------->ANAC46    <---------ARR14(2)       <--------
----ZAT18       --------->TCP15(1)            --------->ANAC58    <---------ARR11(3)       ---------
-------TCP20   ----------->HVH21  ------>NtERF2   <---------YAB5 <---------CCA1(2)   ------------>CBF
gctccacaatatcttcatgggacccacaacgcttctccgactaagttacacgaatcatcggccggccaatatcttcaactgcgtgcgaggcaatacgtgt  16387600
                                     <---------RVE1(2)         <---------ATHB12
                                     <---------GATA12        --------->WOX13(1)
      --------->RVE1(2)             --------->KAN1     <---------ANAC58
      <---------ARR14(2)          <--------P           <---------ANAC58
      <---------ARR11(3)      <---------WOX13(1)     --------->ALFIN1                              -
      --------->ARR14(2)     <---------WOX13(2)     <-------MYC3                               -----
      --------->GATA12      --------->ATHB12        --------->TOE2(2)                          -----
      --------->GLK1(2)    <---------AHL20(2)       ------->MYC3                              <-----
  --------->YAB1           <---------YAB1           ------->MYC2                        <---------ZAT18
 XXXXXXXXXXXXXXXXXXXX>MIR1888--------->WOX13(2)     <-------MYC2                        --------->ZAT18
--------->RVE1(2)         --------->AHL25(3)        --------->TOE1(2)                ------>ZmHOX2a(2)
-ANAC55(2)                --------->AHL20(2)       <---------ANAC58                 <------ZmHOX2a(2)
-ANAC58               <---------ANAC58             <---------ANAC58    =============================
-ANAC58  ----------->GT1 <----------DOF2    <---------KAN1<-----------HVH21        <---------GATA12-
-ANAC55(1)            <---------ANAC58 <-------TEIL--------->KAN1      ---------->DOF2  --------->DEAR3(1)
>ANAC55(2)            <---------ANAC46--------->ARR14(1) --------->ANAC46          --------->GATA12-
caaaatcaaaatctgtaaaaaacttgcgttttaattggtagattcgaatttgaaacgtgcgcgtcaatgagtttaaaagctcgtgagatcgcccactatg  16387700
                               <---------DEAR3(2)                  --------->RVE1(2)
                             <---------LBD16                 --------->LBD16                  ------
            --------->ARR14(2) <---------At4g35610          --------->ANAC58                 <------
    --------->ANAC58   <--------ATHB1------>NtERF2          --------->ANAC58                 <------
    <---------O2       --------->KAN1<---------RRTF1(1)     <---------ANAC55(2)              -------
    --------->O2       --------->YAB5<---------ERF1         --------->ANAC55(2)              <------
    --------->ANAC46  --------->AHL12(1)    <------ZmHOX2a(1)----------->GT1                 -------
    --------->ANAC58  <---------KAN1<---------ATERF1(2)     <---------HSFB2a(2)              -------
    --------->TGA1a   <---------AHL25(1) --------->ATERF1(1)<---------ANAC46                <-------
-------->ANAC58    --------->YAB5----------->HVH21  --------->ALFIN1                      <---------SPL7(1)
---->YAB1   <---------ARR14(2) --------->At4g35610  <---------DEAR3(1)                  <---------ZAT6
---->YAB5   <---------ARR11(2) --------->LBD16 --------->MYB52(1)--------->DOF5.7(1) <---------AtMYB61
----YAB1    --------->ARR11(2)<---------DEAR3(1)    <---------AtMYB61                --------->ALFIN1
==============bZIP_DOF<---------AHL12(1) <------NtERF2     <---------LBD16           <---------DEAR3(1)
-------->ANAC46 <---------At4g35610 <---------RRTF1(2)   <---------SPL7(1)      --------->MYB52(1)--
-------->ANAC58 --------->At4g35610--------->ATERF1(1) <---------ZAT6        <------ZmHOX2a(1)------
ataagccacgactcgtttccgatgaataattcgccggtgacggcggaggagaacggtggtgttacggaaaaatccatacaggagaacggtggtgttacgg  16387800
      <---------DOF5.7(1)                                                                      <----
--------->RVE1(2)                                                            --------->ANAC55(2)   -
--->LBD16                                  --------->WOX13(1)                <---------ANAC55(2)<---
---ANAC46                        --------->ARR11(3)                          <---------ANAC55(1)<---
---ANAC55(2)                     <---------ARR11(3)                          <---------ANAC46-------
-->ANAC58                        --------->RVE1(2)                       <---------AHL12(2)  <------
---HSFB2a(2)                     <---------ARR14(2)                      --------->WOX13(2)  -------
-->ANAC55(2)                     --------->ARR14(2)                      --------->AHL12(2)<--------
-->ANAC58                       --------->RVE1(1)                        <---------WOX13(2)<--------
--LBD16<---------AHL20(2)       --------->CCA1(1)                   ----------->GT1        ---------
------->DOF5.7(1) ------>ZmHOX2a(1)  ----------->GT1         --------->GLK1(1)             ---------
----->GT1    ---------->ID1 --------->AHL20(2)               <---------GLK1(1)        <---------AHL20(2)
aaaaatccatttttttgtctccttctactaagaaaatatctggtatcaatcttctctgtatgagaaatctctggtaaattatgtgttatataaaaacgta  16387900
-->TEIL                                     --------->DOF5.7(1)
-----TOE2(2)                               --------->DOF5.7(1)  <------NtERF2
------>TEIL                                --------->DAG2      <---------MYB46(3)
------ANAC55(2)                           ---------->DOF2      <---------ATERF1(1)
------ANAC46                           --------->LBD16         ------>NtERF2
-->TOE1(2)                            <---------ATERF1(2)    <---------MYB52(1)
---SPL7(1)                      --------->ARR11(2)          --------->LBD16
-->TOE2(2)                      <---------GLK1(2)      --------->At4g35610         <---------RVE1(2)
-------AtSPL3        <----------DOF2  --------->ATERF1(2) <---------LBD16        <---------MYB46(3)
-------AtSPL8        <---------DAG2  <---------LBD16   <---------At4g35610     --------->At5g28300
------>AtSPL3   --------->YAB1  <---------ARR14(2) <---------KAN1            <---------DEAR3(1)  ---
------>AtSPL8  <---------YAB5   --------->ARR14(2)--------->GLK1(2)     --------->LBD16<---------YAB5
cgtatatatatgagtttattcatactttaccttcagaatcgccggtaaaggagaatttagctccggtggctactccgaagacggtggataatggtttaag  16388000
                                                 <---------ANAC58        ---------->ID1<------------
                                                 <---------ANAC58 <------------------------ANAC81 --
                <---------MYB46(3)        <----------DOF2      <----------DOF2        <-------------
               <---------AtMYB61        <---------HSFC1(2)    <---------DOF5.7(1)     <-------------
        --------->ARR11(3)   --------------->AGL15           <---------YAB5           --------------
        --------->GATA12     <---------------AGL15          <---------ARR11(3)        <-------------
        <---------GATA12   <<<<<<<<<TBF1--------->HSFC1(2)  --------->GLK1(2)     --------->WOX13(2)
------>ZAT18   --------->ALFIN1        --------->GLK1(2)--------->YAB1 <-----------RAV1(1)   <------
tgctcaagtgaaatctcggtggtcgttttcttcttctaagagaagctttggtacttgtttcataatctttttttttgttgttttcaatttccttttatgg  16388100
<- Previous    Next ->

AGI:  At5g40860.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G27210.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN62725.1)
Range:  from: 16387596    to: 16389213    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.