Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         --------->ANAC58                                                         <---------At4g35610
       ------>NtERF2<---------ARR11(2)                                            <------NtERF2
       <------NtERF2--------->ARR14(2)                                       --------->DAG2
  --------->DOF5.7(1)  --------->KAN1                                        --------->DOF5.7(1)
  --------->DAG2    <---------ARR14(2)                                      ---------->DOF2
-----MYB46(3)     --------->LBD16                      <-------TEIL         --------->DOF5.7(1)    -
------>GT1       --------->LBD16                    <------ZmHOX2a(1)   <----------ID1        ------
----TOE1(2)     <---------LBD16                 --------->DOF5.7(1)<---------AtLEC2           <-----
----TOE2(2)    ------->GAMYB <---------RVE1(2)---------->DOF2<---------YAB1---------->DOF2    <-----
gttataaggcggacacaaccccggttatgttcgatatagatgaagaagagaaagaggatgcattgtgtttgcatagcgaaaaggcagcgattgcatttgg  16188200
                              <---------GATA12                                            <---------GLK1(2)
                              --------->ARR14(2)                                          --------->ARR11(3)
                              --------->ARR11(2)                                   ------>ZmHOX2a(2)
                        --------->ARR14(2)                                        --------->GLK1(1)
                        <---------ARR14(2)                                       <---------GATA12
                        --------->GATA12 --------->HSFB2a(1)                     --------->ARR11(3)
                        <---------ARR11(2)                                       --------->GATA12
 <---------YAB5         <---------GLK1(2)<---------HSFC1(2)                      <---------ARR11(3)
-------->YAB1    --------->KAN1<------ZmHOX2a(2)              <---------YAB5   <---------YAB1
----->GT1       --------->ARR11(3)      ------->TEIL    <---------RVE1(2)    --------->YAB5
-MYB46(1)       <---------ARR11(3)     <---------ARR14(2) <---------RVE1(2)  --------->YAB1<--------
-MYB83   ---------->DOF2--------->ARR11(2)        <---------AtMYB61         <---------YAB1<---------ARR11(3)
tataatgagtttgaaagaagatgttccgattcggatcgtgaagaaccttcgggtttgtggagattgtcatcaggtttctatgatgatctccaagattttt  16188300
       --------->ATHB12                                                                      <------
      <---------YAB1                                                                         <------
      <------ZmHOX2a(2)      --------->ARR11(2)                                --------->GLK1(2)
     --------->ARR11(3)      <---------ARR11(2)                     <----------DOF2        <--------
     <---------ARR11(3)      <---------ARR14(2)                    <---------ANAC58------>MYB83
-RVE1(1)   <-----------HVH21 --------->ARR14(2)                    <---------ANAC58------>MYB46(1)
aacagagagatcattgtcagagacagaaacaggttccaccatttcaaagatggtcactgttcttgtaatggcttttggtgagaacctagctatgtaacca  16188400
                                                        --------->ANAC58     <---------AHL20(2)   <-
                                                        --------->ANAC58    --------->AHL25(3)    <-
                                                    --------->YAB5          <---------YAB1        --
                                                    --------->YAB1         <---------AHL12(3)     <-
   --------->WOX13(2)                            <---------ICU4            --------->AHL12(3)     <-
   <---------WOX13(2)                            --------->YAB1            --------->AHL12(2)     --
 <---------AHL20(2)      <---------TOE2(3)      --------->ICU4             <---------AHL12(2)     --
 --------->AHL20(2)     <-----------GT1         <---------YAB1           --------->ICU4           <-
 --------->AHL25(3) <---------RVE1(2)         --------->YAB5            <---------RVE1(2)        ---
------MYB.PH3(1)   --------->ATHB12          <---------YAB1    <---------AHL20(2)                ---
---YAB5           <---------YAB5    ----------->GT1<---------YAB1   ----------->GT1         --------
---GT1 <-----------GT1 ----------->HVH21     --------->ICU4   --------->AHL20(2)            --------
ttttttaatttcacctagttagtgatttgacgatttcagaggtaaaacatgattatgataagaaatttaaaatgtgatatttattgtttatccaatagta  16188500
---------AHL25(3)         <---------ANAC58
-------->AHL25(1)     <---------WOX13(1)
-------->AHL25(2)    <---------WOX13(2)
---------AHL25(1)    <------------CBF
---------AHL20(2)    --------->WOX13(2)
---------AHL25(2)   <---------AHL25(3)
---------AHL12(3)   --------->ATHB12
-------->AHL12(3)  <---------AHL25(3)
--------AHL20(2)   <---------AHL25(2)                --------->WOX13(2)
------->AHL20(2)   --------->AHL20(1)                <---------WOX13(2)
------->AHL12(3)   <---------AHL12(1)                <------------CBF
------->AHL12(1)   --------->AHL12(1)              <---------------AGL15
--------AHL20(1)   <---------AHL20(1)              --------------->AGL15
--------AHL12(1)   --------->AHL20(2)           <-----------GT1
------->AHL25(3)   <---------AHL25(1)         <---------WOX13(2)                                  --
--------AHL25(3)   --------->AHL25(1)         --------->WOX13(2)                                 ---
--------AHL25(2)   <---------AHL20(3)        <---------ICU4                                   ------
------->AHL25(2)   <---------AHL20(2)     ----------->GT1                                   <-------
------->AHL25(1)   --------->AHL25(3)     --------->YAB1                   <------MYB46(1)  --------
--------AHL25(1)  --------->AHL12(2)  --------->DOF5.7(1)                  <------MYB83   ----------
------>AHL12(2)   --------->AHL25(3)  --------->ICU4--------->ATHB12      --------->MYB59<----------
------>ICU4      <---------WOX13(2)<---------------AGL15              <---------TOE2(3) ---------->DOF2
--->GT1          --------->WOX13(2)================================MADS_MADS<<<<<<<<<<MYB80---------
->YAB1       ----------->GT1     --------->YAB1--------->ICU4    <----------DOF2   <------ZmHOX2a(1)
attttttttttgaagccagtaattaattggcgttaatagtaaaaatggtaattactaattggagaaggcttttaagtttggtttgaggagagaaagataa  16188600
 *TSS                                            --------->AHL20(3)
---------->CBF                                   --------->AHL20(2)         <---------GATA12
------>YAB1     --------->ANAC58                 <---------AHL12(3)         --------->GATA12
--->YAB1      ---------->DOF2                  <---------RVE1(1)            --------->GLK1(2)
--ARR11(3)  <---------YAB1                    --------->ARR11(3)           --------->WOX13(1)
->ARR11(3) --------->RVE1(2)                  <---------GLK1(2) <---------RVE1(2)
->GT1     --------->YAB5     <---------YAB5   <---------RVE1(2) --------->ARR11(3)
-----------WRI1 --------->ANAC58     ---------->DOF2       <---------DEAR3(1)                      <
>YAB1  <---------At4g35610 <---------ARR11(2) --------->GATA12  <---------ARR11(3)                 -
taacaatgagagatgatcaaagcaaatgtgtattcatgttcaaagttcagatttttatatcgtcggagatttttgagccaatctagttttgttcatagtt  16188700
                                                                         ---------->DOF2       <----
                              --------->ZAT14               <---------MYB52(1)                ------
                              ---------->DOF2             <---------ANAC58                    <-----
       --------->YAB5      <----------DOF2                <---------ANAC58       --------->ZAT14  <-
 <-------TEIL            <---------At4g35610              <---------ANAC46--------->DAG2      <-----
---------GATA12          --------->At4g35610     <---------ZAT14   --------->ATHB12    --------->ALFIN1
-------->GATA12       <---------At4g35610        --------->ZAT14 <----------DOF2 <---------ZAT14 ---
tagatgcaaatgtttcatcacttatagctgctgtaaagtcttgtgtctccattgaactgtgtcgtttgcttcattgtaaagtagtgaagagtgtgagtta  16188800
        <---------AHL20(2) --------->MYB55(2)
        --------->ATHB12   <------MYB83
---->NtERF2                <------MYB46(1)
-----DOF5.7(2)             <---------MYB46(3)
-----At5g28300            <---------AtMYB61
--->ARR11(2)             <--------P<---------ANAC46  <---------YAB1
------GT1             <----------DOF2    <---------RVE1(2)  <---------ZAT14
--------RAP2.6(3)   <---------ZAT2 --------->ANAC55(2)      --------->ZAT14
----ARR11(2)        --------->ZAT2 <---------ANAC55(2)      --------->ZAT18
------>ANAC46  <---------PCF5 <---------MYB46(3)  --------->ICU4   --------->GLK1(2)          <-----
ccgccatggatttattggggaccagcttgttggttgttacttgagattgggtcatgatgtttgtgcagagaagctgttcgatgaaatgcctgagagagat  16188900
                     <---------LBD16                                              --------->ARR11(3)
                   --------->ARR14(2)                                            <---------GLK1(1)
                   <---------ARR11(3)                                            --------->GLK1(1)
                   --------->RVE1(2)                                        --------->YAB5
                   <---------ARR14(2)                                       --------->YAB1  <------MYB83
                  --------->RVE1(1)       --------->MYB52(2)             --------->YAB1 <---------O2
         <---------GLK1(1)     <---------LBD16                           <------ZmHOX2a(1)--------->ALFIN1
   <---------ANAC46--------->ARR11(3) ----------->GT1       <---------TOE2(3) <---------YAB1<------MYB46(1)
----GATA12   <----------DOF2  <---------LBD16 <---------LBD16  --------->ALFIN1 <---------ARR11(3)
ttagtctcttggaactctttaatatctgggtattcagggagaggttatttggggaaatgttttgaggtgttgtctaggatgatgatatctgaggtgggtt  16189000
              --------->ANAC55(2)                                                   <------MYB46(1)
              <---------ANAC55(2)                                                   <------MYB83 <--
              <---------ANAC46              <---------LBD16                        --------->ALFIN1
              <---------ANAC58            <---------ARR11(2)                       <---------MYB46(3)
              <---------ANAC55(1)         --------->ARR11(2)                       --------->MYB55(2)
              <---------ANAC58         <---------ANAC46                            --------->MYB46(2)
            <-----------GT1        <---------ANAC58                                <---------AtMYB61
           <---------ARR11(2)      <---------ANAC46                                --------->MYB111(2)
      <---------ATHB12             <---------ANAC58       <------ZmHOX2a(1)        --------->MYB111(1)
     --------->WOX13(2)       ===================================HOX2a_HOX2a       <---------DEAR3(1)
     <---------WOX13(2)       ------>ZmHOX2a(2)         <---------TOE2(3)         <---------MYB55(1)
    ------>MYB83            <-----------ARR10<---------ANAC46               --------->ATHB12     <--
    ------>MYB46(1)         <---------ARR11(3)<---------LBD16              <---------YAB5     >>>>>>
  <---------MYB59           --------->ARR11(3)--------->LBD16    <------ZmHOX2a(1)<--------P  >>>>>>
ttagacctaatgaagttacgtttttgtcgatgatctcggcttgtgtttacgggggaagtaaggaagaaggacgttgtattcatgggttggtgatgaaatt  16189100
<- Previous    Next ->

AGI:  At5g40405.1   
Description:  binding. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G66520.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41028.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 16186543    to: 16188381    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At5g40410.1   
Description:  binding. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT1G08070.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN69113.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61988.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 16188602    to: 16190454    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.