Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          --------->AHL20(2)               --------->YAB1   <---------AHL12(3)
                         <---------AHL12(2)               <---------ZAT6    <---------AHL20(2)
                        --------->AHL12(2)                ----------->GT1  <---------AHL25(3)
                        <---------AHL12(2)              --------->YAB1     --------->AHL20(3)
                       <---------AHL12(1)          <---------AHL12(2)      --------->AHL25(3)
                       --------->AHL25(2)         --------->AHL12(2)       --------->AHL20(1)
                       <---------AHL25(1)         <---------AHL25(3)       <---------AHL20(1)
                       <---------AHL25(2)         <---------AHL12(2)       <---------AHL20(2)
                       --------->AHL25(1)        <---------AHL12(1)        --------->AHL20(2)
                       <--------ATHB1            --------->AHL12(3)        <---------AHL12(1)
                       --------->ATHB51          --------->AHL12(1)        --------->ARR11(3)
                       <---------ICU4            <---------AHL12(3)        <---------ARR11(3)
                       --------->AHL12(1)        --------->AHL20(2)        <---------AHL20(3)
                       --------->AHL20(2)        --------->AHL25(1)        <---------AHL25(2)
                       <---------AHL20(3)        <---------AHL25(3)        --------->AHL25(1)
                       <---------AHL25(3)        <---------AHL25(1)        --------->AHL12(1)      -
                       --------->AHL20(3)       --------->ARR11(3)         --------->AHL25(2)    >>>
                      --------->ICU4            --------->AHL25(2)         <---------AHL25(1)  -----
                      <---------YAB1            --------->AHL25(3)    <---------AHL20(3)       <----
                      --------->AHL25(3)        <---------ARR11(3)    --------->AHL20(3)      ------
                     --------->AHL20(3)         --------->AHL12(2)    --------->AHL25(1)    <-------
                     <---------AHL20(3)         --------->AHL12(1)    --------->AHL20(2)  --------->AHL20(2)
            <---------WOX13(1)--------->YAB1    --------->AHL20(1)    <---------AHL20(2)  --------->AHL20(1)
           <---------ANAC58  <---------YAB1     <---------AHL12(2)    <---------AHL20(1)  --------->AHL25(3)
           <---------ANAC58--------->YAB1       <---------AHL25(2)    --------->AHL20(1)  <---------AHL25(2)
          --------->ATHB12<---------AHL20(2)    <---------AHL12(1)    --------->AHL25(2)  <---------AHL25(3)
         <---------YAB1<---------AHL20(2)       <---------AHL20(1)    <---------AHL25(1)  --------->AHL25(2)
 --------->YAB1      --------->AHL25(2)        --------->YAB1 --------->AHL20(2)          <---------AHL20(1)
 --------->AHL25(1)  --------->AHL12(2)        --------->AHL12(2)<---------AHL20(1)       <---------AHL20(3)
 --------->AHL20(2)  <---------AHL25(2)        --------->AHL12(3)<---------AHL25(2)       --------->AHL25(1)
 --------->AHL12(3) --------->YAB1       --------->RVE1(2)<---------YAB5  <---------------AGL15-----
 <---------AHL20(2)<---------YAB1--------->AHL20(2)--------->AHL12(3) <---------AHL25(2)  --------->AHL20(3)
------->TOE2(3)  --------->YAB1  <---------AHL20(2)<---------AHL12(3) --------->AHL25(3) --------->YAB1
acatttatattgttgattgttcataataatttataataaaactaaatcaaaaatatttatagtgataatataatataatatatttggaacaaatataata  8661700
                            --------->AHL12(3)                 --------->At4g35610
                            <---------AHL20(2)                 <---------At4g35610
                            --------->AHL20(2)             <---------RVE1(2)  --------->ARR11(2)
--------->DOF2              --------->YAB1                 <---------GATA12   --------->ARR14(2)
>>>>>>RAP2.2                --------->AHL25(1)     <---------ALFIN1   --------->O2       <----------DOF2
---->RVE1(2)          ------->GAMYB   <---------ANAC58     --------->GATA12   <---------ARR14(2)
-----ARR11(3)        --------->MYB46(3)<---------WOX13(1)  <---------ARR14(2) <---------ARR11(2)
--->CCA1(1)         -------->P        <---------ANAC58     --------->ARR14(2) --------->GATA12
--AHL12(2)       <---------MYB52(2)  --------->ATHB12    ----------->ARR10    --------->RVE1(2)
---->ARR11(3)  --------->ZAT6       <---------YAB1 --------->ANAC46   <---------O2       ------>ZmHOX2a(1)
tctaaagcatcaagtttcacactaaccacatttatattgttgattgtttatcacacaccgtagatttgctgccacgagtcaaatccacaatccttttcgc  8661800
                                <---------AHL12(2)                                                <-
                               --------->AHL20(2)                                                 <-
                               --------->YAB1                                                   <---
                              <---------YAB5                                                 <------
                              <---------YAB1                                            --------->KAN1
                             --------->WOX13(2)                                        <---------AHL20(1)
                           --------->AHL25(1)                     <---------CCA1(2)    --------->AHL25(2)
                  <---------RVE1(2)    --------->ANAC58         <---------DOF5.7(1)    <---------AHL25(2)
             <----------DOF2 <---------WOX13(2)       <-----------GT1                  <---------AHL20(3)
      -------->ZAP1        --------->AHL20(2)   --------->YAB1  --------->TOE2(3)      --------->AHL20(1)
    <---------WRKY18(1)    <---------AHL20(2) --------->RVE1(2) <---------DAG2         <---------AHL20(2)
   --------->WRKY12--------->KAN1      --------->ANAC58      <-----------GT1           --------->AHL20(3)
   ----------->HVH21  <---------YAB5   --------->ANAC46    --------->RVE1(2)  <-----------RAV1(1) <-
aagcgtttgacccagacttttgatactcgtttaattataaacacacaaatatcaaaataacatatcaccttatcttgaaaattgtggcattatattcttt  8661900
           --------->AHL20(2)         <---------YAB1           --------->TOE2(3)
           --------->YAB1<---------AHL12(2)              --------->AtMYB61              ----------->GT1
           <---------AHL20(3)       --------->YAB1       <---------ALFIN1               <---------ANAC58
          <---------KAN1<---------AHL25(3)         --------->ANAC58                     <---------ANAC46
 --------->ZAT18       <---------AHL25(3)          --------->AtLEC2                     <---------ANAC58
--------ANAC58         --------->AHL25(3)          --------->ANAC58           <---------WOX13(2)
--------ANAC46       <---------WOX13(2)            --------->ANAC46           --------->WOX13(2)
------ANAC46         --------->WOX13(2) ---------->DOF2------>NtERF2        <---------AHL20(2)    --
----DOF2--------->YAB1 <---------AHL25(1)        <---------ANAC58         <---------ANAC55(2)     <-
--------ANAC58 <---------YAB1      <---------YAB1<---------ANAC58         --------->ANAC55(2)  -----
tgtgtggacaagaataatatgcttaattaaataaacttataatgaaagacttccatgccaccacatccttgaagcttatgtaattgaaatgtcgtgaaat  8662000
      <---------ATHB51                                                    --------->ANAC58
      <---------AHL12(3)        <------------CBF                          --------->ANAC46
      <---------AHL20(2)       -------->ATHB1                       --------->RVE1(2)
      --------->AHL20(2)       --------->YAB1                      --------->KAN1
      --------->AHL25(1)       <--------ATHB1                    <---------AHL12(2)
      --------->AHL25(3)       --------->ATHB12                  ----------->TBP
      <---------AHL12(1)       --------->ATHB51                --------->AHL20(2)
      --------->AHL12(1)       <---------ICU4                  --------->YAB1   ---------->DOF2
     --------->AHL12(2)       --------->ICU4                   <---------AHL20(2)
     <---------AHL12(2)       <---------YAB1                   --------->AHL25(1)
    --------->AHL12(2)     ------------>ATHB5              --------->ICU4 --------->ANAC58
  --------->AHL20(2)       --------->ICU4    --------->DOF5.7(1)<---------AHL25(3)
--------->GT1             ------------>CBF ---------->DOF2------------>CBF<---------ALFIN1
--------ANAC46         <-----------TGA1    --------->DOF5.7(1) <---------AHL25(1)        ---------->DOF2
---->ICU4 --------->AHL12(1)  <---------ATHB51         <-----------TGA1 ----------->RAV1(1)  -------
gatgtataaataattaaatatgaaatcgtcacaattattgctcaaaaaaagaagaaatcgtcacaattatatatcccacacaacaaagtccaaaaagaaa  8662100
                           --------->DOF5.7(1)                    <---------ARR14(2)
                          ---------->DOF2                         <---------ARR11(3)
                 ----------->GT1                                 <---------CCA1(2)
                 <----------ID1                       >>>>>>>>>RAP2.2
               --------->DOF5.7(1)                  --------->RVE1(2)
               ---------->DOF2   ----------->RAV1(1)<---------ARR11(3)               --------->RVE1(2)
        ----------->RAV1(1)--------->DAG2           --------->ARR11(3)   <---------CCA1(2)
 *TSS  --------->MYB46(3) --------->DOF5.7(1) ----------->GT1 XXXXXXXXXXXXXXXXXXXX>MIR774B*
--->DOF2------------------------>ANAC81   ---------->DOF2   --------->RVE1(2)       <---------CCA1(2)
gaagttatcaacaacaaaaaaagaaaaaaaaaagtcccacaaacacaaagtgtaatatctaaaaatccatatctccatctctcccctctatctatcgctc  8662200
                         <---------KAN1     ------>ZmHOX2a(1)   --------->ANAC55(2)
                       --------->YAB1    <---------YAB5       <-----------GT1<---------AHL20(3)
           <---------LBD16         <---------TOE2(3)       <---------ICU4 <---------WOX13(2)
     --------->KAN1---------->DOF2 <---------TOE1(3) --------->RVE1(2)--------->TOE2(3)      -------
cctctctctaattcttcggacacaaagcataagacttgaaggtaatcctacagaaatatcaaatattacatattctcaattattattttttaaacacaaa  8662300
                     <---------AtLEC2                          <---------YAB1  --------->AHL25(1)
                     <---------ANAC58                          --------->ANAC46<---------AHL25(2)
                     <---------ANAC58                        <---------ICU4    --------->AHL12(2)
                <-----------RAV1(1)                 <---------GLK1(2)          <---------AHL20(2)
                <---------KAN1   -------->ZAP1      --------->ARR14(2)         <---------AHL12(3)
                --------->HSFB2a(1)--------->At5g28300     <---------WOX13(2) <---------AHL12(1)
      <---------ANAC58         <---------WRKY18(1) <------ZmHOX2a(1)      --------->ICU4
      <---------ANAC58        ----------->HVH21  <---------TOE2(3)        <---------YAB5           -
  <----------DOF2    <---------ANAC46  ---------->DOF2     --------->WOX13(2) --------->AHL12(1)  <-
--->DOF2--------->KAN1 <---------KAN1--------->REM1(2)    <---------ICU4  <---------YAB1   ---------
gtgttctttacttgttcgaatgttgcatgtctcttgaccgtgaaaagaaatttaggattcttcattacgacagagtgatgattttttttgttttgccaaa  8662400
          --------->YAB5                                     --------->ATHB12                   <---
         --------->ICU4                                      <---------MYB46(3)                 ----
         <---------YAB1  --------->AHL25(3)  <---------AHL20(3)  --------->YAB5               ------
---------->RAV1(1)   <---------MYB46(3)      --------->AHL20(3)  --------->ATHB12          <--------
---------ID1     <---------AtMYB61           --------->AHL12(3)<---------WOX13(1)     <----------DOF2
-------->AGL1  <----------DOF2<---------AHL20(2)            <---------YAB1   <----------DOF2 -------
aacgacagagtgatgatgctttggtggttttattttatggggttctatatttttcatctattggtgattgattacaaaaacttttaagactttagataat  8662500
------AHL25(2)                                                            --------->AHL12(1)
------AHL25(1)                                                        --------->HSFB2a(2)
----->AHL25(2)                                                  <---------ARR11(3)
------AHL20(3)                                                  --------->GLK1(2)
------AHL12(1)                                                 --------->CCA1(1)
----->AHL12(1)                                                 --------->RVE1(1)          <-------MYC3
--->AHL12(2)                                      --------->YAB1--------->ARR11(3)        ------->MYC3
-RVE1(2)          --------->RVE1(2)              <-------TEIL --------->AHL12(1)--------->O2    <---
-->AHL20(2) <----------DOF2            --------->TOE2(3)      <---------AHL12(1)<---------O2    <---
atatttttgttgagtctttaaaatccaattttcttgaatcaaacttaacacattcatagccctaaaaaatcttctaaaatttctcgtggcccatgtgttt  8662600
<- Previous    Next ->

AGI:  At5g25120.1   
Description:  CYP71B11 (cytochrome P450, family 71, subfamily B, polypeptide 11); oxygen binding. Identical to Cytochrome P450 71B11 (CYP71B11) [Arabidopsis Thaliana] (GB:P58049;GB:Q67Y45); similar to CYP71B14 (cytochrome P450, family 71, subfamily B, polypeptide 14), oxygen binding [Arabidopsis thaliana] (TAIR:AT5G25180.1); similar to CYP71B12 (cytochrome P450, family 71, subfamily B, polypeptide 12), oxygen binding [Arabidopsis thaliana] (TAIR:AT5G25130.1); similar to CYP71B13 (cytochrome P450, family 71, subfamily B, polypeptide 13), oxygen binding [Arabidopsis thaliana] (TAIR:AT5G25140.1); similar to Cytochrome P450 71B1 (CYPLXXIB1) (GB:P49264); conta
Range:  from: 8662102    to: 8664536    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.