Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                    <-----------GT1                          <------ZmHOX2a(2)
       --------->GLK1(1)                         ================================RAV
       <---------GLK1(1) --------->KAN1 --------->At4g35610 <---------ARR11(3)                    --
       <---------At4g35610              <---------At4g35610 --------->ARR11(3)                   ---
       --------->At4g35610       --------->WOX13(1)         --------->RVE1(2)         --------->TOE2(3)
---->At4g35610   --------->ARR11(2) --------->YAB1   <<<<<<<GRF7              --------->At4g35610---
--NtERF2    ------>ZmHOX2a(1) ------>ZmHOX2a(1)  ----------->RAV1(2)   <---------ALFIN1         ----
-----At4g35610   <---------ARR11(2)<---------ATHB12----------->HVH21 ----------->RAV1(1) ---------->DOF2
cgaagtatggagctcctgtgtattcacgacatcctccaatcacagctatcttccctgacacaagatcaattccaacacatgagctaaaacatcaaagtaa  6428100
             --------->TOE2(3)           --------->AHL20(2)                       --------->ZAT2
             --------->TOE1(3)           <---------AHL20(2)                       <---------ZAT2 <--
--------->GT1<----------DOF2             --------->AHL25(3)                    --------->MYB46(3)<--
------>TOE1(3)                     <---------KAN1<---------At4g35610   --------->ANAC58          <--
------>TOE2(3)          ---------->DOF2  <---------AHL12(1)            --------->ANAC58   <---------
------->RAV1(2)        ------>ZmHOX2a(1) --------->AHL12(1) --------->AHL20(2)-------->P <---------DOF5.7(1)
cctgaaaaaactcaaactttaaaatcctaaagtttcgaatttgataaatttctgatgacacaattgaatagagcaagcactaaccagcttggcctttgtg  6428200
                   <------NtERF2                          --------->ALFIN1
                  <-----------HVH21                     <---------bZIP60(2)
                  <-----------TGA1                      <---------ANAC46
                 <---------TGA2(1)                   ----------->HVH21               --------->PCF2
                 <---------ANAC58                  <---------At4g35610             ----------->HVH21
                 --------->TGA2(1)             <---------ATERF1(1)           --------->YAB5
                 <---------bZIP60(1)           <---------DEAR3(2)            --------->ATHB12
                 --------->bZIP60(1)           ------>NtERF2                <---------YAB5
                 <---------ANAC46             <---------DEAR3(1)            <---------YAB1         <
      <------ZmHOX2a(2)                       --------->DEAR3(1)            --------->ICU4 ---------
     <---------GATA12    --------->ARR11(2)  --------->ATERF1(1)          --------->YAB1----------->RAV1(1)
-------ANAC58    <---------ANAC58         <---------At4g35610             <---------At4g35610  <----
-------ANAC58 <---------DEAR3(1) --------->ZAT14<------NtERF2    --------->ATHB12<------MYB83  <----
-------ANAC46<xxxxxxxxxxxxxxxxsmallRNA(s) --------->At4g35610    <---------ICU4  <------MYB46(1)   <
-DOF2--------->GATA12    <---------ARR11(2) <-----------HVH21 <---------GLK1(1)<---------WOX13(1) <-
tcgtttgagatcgagcgatggcgtcacggttctaagaacactctcagcgtcggcctctgatgtggaactcattgctctgatgattggtgacccacaaagc  6428300
  --------->SPL7(1)                 >>>>>>>>>TBF1                    --------->ANAC46
<---------SPL7(1)         <---------ZAT14                            --------->ANAC58
---------ANAC58           <---------ZAT18                            --------->ANAC58           ----
->DOF2  <---------ARR11(3)--------->ZAT18                      <---------SPL7(1)                ----
-----ANAC58             --------->ZAT14            --------->YAB1--------->SPL7(1)             -----
-----ANAC58             --------->At4g35610 ----------->GT1  <---------ATHB12                -------
---------ANAC58         <---------ZAT18>>>>>>>>>TBF1       --------->WOX13(1)              ---------
------TEIL              <---------At4g35610--------->DOF5.7(1)--------->YAB1    <---------RVE1(2)
gttcgtaccaagaactcttgccttctgagcacacttgaagaagaagaaggtgaatgagaagtcaatcgtaccaagccagagatgatactgggcttcacca  6428400
    --------->GLK1(2)                                                                         <-----
   <---------GATA12                                                                           ------
   --------->GATA12                                                                          -------
   <---------GLK1(2)                                                                         -------
   --------->ARR14(2)                                    --------->ZAT18                    --------
   <---------ARR14(2)           <---------ALFIN1         --------->ZAT14                    --------
   <---------RVE1(2)          ------>NtERF2              <---------ZAT14            <---------ANAC58
   --------->ARR11(2)        --------->DEAR3(1)   <---------HSFB2a(2) <------MYB46(1)     <---------AHL20(2)
 ----------->ARR10        --------->ANAC58   <---------At4g35610      ----------->GT1    --------->AHL25(3)
-->MYB83                  --------->ANAC58---------->DOF2<---------ZAT18       --------->HSFB2a(1)--
-->MYB46(1)             ---------->DOF2 <---------ARR11(2)            <------MYB83  <---------ANAC46
------>RAV1(1)       <------NtERF2      --------->ARR11(2)          *TSS       <---------HSFB2a(1)<-
-->MYB46(3)    <---------ANAC58 --------->DEAR3(1)--------->HSFB2a(2)--------->MYB59<---------ANAC58
>REM1(1)       <---------ANAC58<------NtERF2 <---------ZAT14       <---------MYB52(1)  <---------DOF5.7(1)
acatcagattctctcgttgagggccgagaaagccaccgcttccgatacagcaccgagaagtgaactctctgtttggttaagaaggtttcgtttttattta  6428500
--->AHL12(1)                                                                         <---------WOX13(1)
--->AHL20(3)                                                                      --------->ALFIN1
----AHL12(1)                                                                  --------->SPL7(1)
----AHL25(1)            --------->ANAC58                                      <---------ORA47(1)
----AHL20(3)            --------->ANAC58                                     ------>NtERF2
----AHL12(3)           --------->DAG2                                       ----------->HVH21
--->AHL25(1)   <------ZmHOX2a(1)                                            <---------SPL7(1)
-->AHL25(3)   <----------ID1                                                --------->ZAT18
-->AHL20(2)   ----------->GT1  <----------DOF2                            <---------At4g35610
->WOX13(2)   ----------->GT1   <---------DAG2                             --------->At4g35610
->AHL12(2) --------->DOF5.7(1) *TSS          <---------TOE2(2)         ---------->DOF2   <---------WRKY12
------->AHL25(1)      --------->DOF5.7(1)    <---------TOE1(2)        <---------REM1(1)  <---------WRKY38(1)
--------AHL12(3)      ---------->DOF2       <------NtERF2     <------ZmHOX2a(1)<---------DEAR3(1)
attattttataggaaagaggaaaaaaaaagcaaactttttcagagtcggaggtttcagacagagaggaagaagatgaagcggacggtgatggacaacgcg  6428600
                       <------ZmHOX2a(2)                <---------MYB46(3)                        --
                       <---------YAB5      <-----------HVH21                                      <-
               --------->ALFIN1         <---------ANAC55(1)                                      ---
               <---------ANAC46         --------->ANAC55(2)    --------->ANAC46                  <--
            <---------AtMYB61           <---------ANAC58<------MYB83          --------->DOF5.7(1)<--
            --------->ALFIN1            <---------ANAC58<------MYB46(1)       --------->DAG2     ---
          --------->MYB55(2)            <---------ANAC55(2)    --------->ANAC58                  ---
          <---------MYB46(3)       <---------MYB46(3)<---------ANAC58       ---------->DOF2      <--
         <---------AtMYB61       <---------MYB52(1)  <---------ANAC58  <---------ANAC58        -----
         <---------DEAR3(1)     <----------DOF2     <---------ZAT2 <----------DOF2           -------
         --------->ALFIN1      <---------DOF5.7(1)  --------->ZAT2<---------DOF5.7(1)      ---------
      <---------DEAR3(1)--------->ATHB12<---------ANAC46----------->GT1<---------ANAC58    ---------
  <------ZmHOX2a(2)    <---------YAB1  --------->MYB52(2)      --------->ANAC58            ---------
attcgatcatcggtggtggtgttgggatcattggcctttggttacttgtcactggagcttggttacaagcctttccttgaaaaggctgaacaatacgaaa  6428700
------>GATA12                   <---------ARR11(3)
------>ARR11(3)                 --------->ARR14(3)
-------ARR11(3)                 --------->ARR11(3)                       <---------YAB5
---->DOF5.7(1)                  <---------ARR14(3)                      <---------WOX13(2)
--->DOF2                 --------->MYB46(3)                             --------->WOX13(2)
>ANAC58             --------->TOE2(3)                               <---------DOF5.7(1)          <--
>ANAC58             --------->RVE1(2)                         <---------ANAC58                 <----
>ANAC46          ----------->RAV1(1)  <---------ZAT6          <---------ANAC58  <---------At4g35610
gatctcttcagtcttctcaacaacatcaacaacaaggtcttgtgttatctctctctctctcaatcgcttgctcttaattgttctgcttctgtttcatttc  6428800
                                  --------->RVE1(2)                                 <---------ANAC58
                                  <-----------GT1                                   <---------ANAC58
                                 <---------KAN1                                <---------YAB1
                               <---------GLK1(2)        <---------YAB1         --------->ICU4
                               <---------RVE1(2)      <-----------GT1        --------->YAB1 --------
          --------->KAN1    <---------WOX13(1)      <---------HSFC1(2)     --------->ARR11(3)
-------At4g35610          --------->ATHB12          --------->HSFC1(2)     --------->RVE1(2)<-------
-----HSFB2a(2)          <---------WOX13(1)   <----------DOF2               <---------ARR11(3)
agaagagatagatttatgctgtgagcgattgatggattatctatttgactttggaagttaccaatgtgtctcgaccaatatcatgatgcgttagagattt  6428900
--RVE1(2)                                              --------->GATA12  --------->HSFC1(1)
--GLK1(2)           <---------At5g28300                <---------ARR11(2)<---------HSFB2a(2)
->ARR11(3)         <-----------GT1                     <---------GATA12  --------->HSFB2a(2)
--ARR11(3)--------->GLK1(2)                   <----------DOF2   <---------DOF5.7(2)
ttgtgaagatgctaatctggttttaccgttttagtaattcaaaacctgtctttgttcggattcaagttaaagttttcgagaattggcactagtacaatag  6429000
<- Previous    Next ->

AGI:  At5g19150.1   
Description:  carbohydrate kinase family. similar to unnamed protein product [Vitis vinifera] (GB:CAO71109.1); contains InterPro domain Carbohydrate kinase (InterPro:IPR000631)
Range:  from: 6426073    to: 6428469    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At5g19151.1   
Description:  unknown protein
Range:  from: 6428532    to: 6429674    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.