Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        --------->MYB52(1)
                                     --------->At4g35610                                ------>MYB83
                                     --------->ZAT2                                   <---------MYB111(1)
                                   <-----------RAV1(2)                                --------->MYB46(3)
                                  <------ZmHOX2a(2)                                   <---------MYB46(2)
                                 <---------ARR11(2)                                 ------>MYB46(1)
                                 <---------ARR14(2)                                 ------>MYB83
                                 <---------GATA12                                  --------->MYB55(1)
                                 --------->GATA12                                 <---------MYB59
                     --------->ARR11(3)                                           <---------MYB111(1)
                     --------->GATA12<---------ZAT2                               <---------MYB46(2)
                     --------->ARR14(2)                                           --------->AtMYB61
                     <---------ARR14(2)                                          --------->MYB46(3)
--------->YAB1       <---------GATA12----------->RAV1(2)             --------->WRKY38(1)------>MYB46(1)
--------->AHL20(2)   <---------ARR11(3)                            <---------At4g35610<---------MYB111(2)
------>YAB1<---------ARR11(3)    <---------RVE1(2)                 <-------GAMYB------>MYB83
->MYB83    --------->ARR11(3)    --------->ARR11(2)                --------->At4g35610<---------MYB59
->MYB46(1) --------->GATA12      --------->ARR14(2)    <---------AHL12(1)       ------>MYB46(1)
----->RAV1(1)       <---------CCA1(2)<---------At4g35610  <---------YAB1        -------->P   <------
->MYB46(3) <---------GATA12    ----------->ARR10  <-------TEIL    <---------MYB46(3)-------->P
 
caataaaaacacaagatttactcaaatcttcaagtagatcagctgaaacaaggttcaatttttcattgtctgttgactaatccaacctaccaaacagaaa  5866300
                                                                                              <-----
                                                                                   <---------ARR11(2)
                                                                                   <---------ARR14(2)
                                                                                   --------->ARR14(2)
                                                                                <---------ANAC58
                                              --------->DOF5.7(1)         <---------KAN1     <------
                        --------->ATHB12      <----------ID1             ------->TEIL<---------ANAC46
                       <---------YAB5       ---------->DOF2          ==============================HOX2a_HOX2a
                       <---------YAB1    --------->LBD16             <------ZmHOX2a(2)      <------ZmHOX2a(1)
                       --------->ICU4   --------->HSFB2a(2)         --------->GATA12 <---------ANAC58
   --------->TOE2(3)<-------TEIL        <---------HSFC1(1)          <---------GATA12 <---------ANAC58
---GLK1(2)     ---------->DOF2          <---------HSFB2a(2)--------->AHL20(2)   <---------ANAC58
 
cttttgcctcaatctatccaaagttcatgatttggattgaattccagaaaagacaaattgaatgaaatagagatcgaacctctgcgtttcttggaggatg  5866400
                             --------->ANAC58
                            <------NtERF2                       <------ZmHOX2a(2)
                           ------>NtERF2                       <---------ARR14(2)
                          --------->DEAR3(1)                   <---------ARR11(3)
                         <---------------------WRI1            --------->ARR11(3)
                        ------->GAMYB                          --------->RVE1(2)
                      ------>MYB83  --------->MYB52(1)    ----------->HVH21
                      ------>MYB46(1)                   --------->At4g35610
                     --------->MYB52(1)                 <---------KAN1
                    --------->DEAR3(1)                 <---------ARR14(2)
                    --------->AtMYB61                  --------->GLK1(2)
                --------->At4g35610<----------ID1      --------->ARR14(2)
               --------->ANAC58  --------->ANAC58      <---------GATA12
               --------->ANAC58  --------->ANAC58      --------->RVE1(2)                       <----
       --------->At4g35610<---------DEAR3(1)          <---------GLK1(2)                <---------ARR11(2)
  <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)          ---------->DOF2       <-------TEIL   <---------ARR14(2)
--------->AHL20(2)  --------->MYB46(3)        --------->ANAC46 --------->GATA12        --------->ARR11(2)
----KAN1    ----------->RAV1(1)---------->DOF2--------->ANAC58 --------->ARR14(2)      --------->ARR14(2)
---GATA12 --------->At4g35610--------->ANAC58 --------->ANAC58 <---------GATA12--------->KAN1  <----
 
taagaaaataagcagcaccagcaccaacggcgacgaaagcaacgaagacacccaaaagaatctgacgatctagggttcggagaaactcggtatccatggc  5866500
                                                                                   --------->RVE1(2)
                                                                                 --------->AHL12(1)
                                                                         <------MYB46(1)
                                                              --------->DOF5.7(1)<---------AHL12(1)
                                                         ----------->GT1<---------AtMYB61
                                                         <----------ID1 --------->ALFIN1
                                                        ----------->GT1 <---------MYB46(3)
                           ----------->GT1             --------->DOF5.7(1)  ----------->GT1
                         ---------->DOF2              --------->DOF5.7(1)<------MYB83
-----ANAC58          >>>>>>>>>TBF1                   ---------->DOF2  <---------ARR14(2)
-----ANAC58  ---------->DOF2                     ----------->GT1      <---------ARR11(2)   <--------
 
ttctcttaacccaaatgaaaggaagaagaaaagtataaaactagcttaagaattgtaaaagggaaaaaatggggattggtggaaaaaatcagagctttga  5866600
                                                                <---------ALFIN1
                                                              -------->P
                                                              ------>MYB46(1)
                                                              ------>MYB83
                                                             --------->MYB55(1)
                                                  <------ZmHOX2a(2)
                                                 <---------RVE1(2)
                                                 --------->GATA12
                                                 <---------ARR14(2)
                                                 <---------GATA12
                                 --------->AHL20(2)         <---------MYB59
                                 <---------AHL20(2)       <---------GATA12
                                 --------->AHL25(1)       --------->GATA12
                                 --------->AHL20(3)     --------->ETT(2)
                                 <---------AHL25(1)    <--------P
                           --------->LBD16       <---------ARR11(2)
                           ------>NtERF2         --------->ARR14(2)
                          --------->ANAC46       --------->ARR11(2)                               <-
               --------------------->WRI1        --------->ARR11(3)<----------DOF2              ----
          <----------DOF2<---------LBD16   --------->ALFIN1 <---------MYB111(1)           <---------
--DOF2   <---------DOF5.7(1)     <---------AHL20(3)------>ZmHOX2a(2)                     <---------DOF5.7(1)
 
attggagttgtctctttcccttgtaatctccgccattaaaatgagggtatgggatctggtagacctaccactttcacgttgtatagtttgcctcttttgc  5866700
                                                           <---------AHL20(3)
                                                           --------->AHL12(3)
                                                           --------->AHL25(2)
                                                           --------->AHL20(3)
                                                           --------->AHL12(2)
                                                           <---------AHL25(2)              ---------
                                                         --------->AHL25(3)    --------->RVE1(2)
                                           <---------AHL25(2)                  <-----------ARR10
                                           <---------AHL25(3)                  --------->ARR14(2)
                                           --------->AHL12(3)                 --------->RVE1(1)
            --------->WOX13(2)             <---------AHL20(2)                <---------AHL25(2)
          *TSS                             --------->AHL25(2)                --------->AHL25(2)
      <---------ICU4                       <---------AHL12(3)               <---------AHL12(2)
      --------->KAN1                       --------->AHL25(1)               --------->AHL12(2)
     <---------YAB1                        <---------AHL25(1)               --------->AHL12(3)
    <---------AHL25(2)                    --------->AHL25(2)                <---------AHL12(3)
    --------->AHL20(3)                    <---------AHL12(1)              --------->AHL25(1)
    --------->AHL12(2)                    --------->AHL25(1)              --------->AHL20(2)
    --------->AHL25(2)                    --------->AHL12(1)              --------->AHL20(3)
    <---------AHL20(3)                    --------->AHL25(3)              <---------AHL20(3)  <-----
   <---------ICU4                         <---------AHL20(1)       ---------->DOF2     <---------DOF5.7(1)
  <---------YAB1                          --------->AHL20(2) <---------AHL12(1)<---------ARR11(3) <-
  --------->ICU4                          <---------AHL25(2) --------->AHL12(1)--------->ARR11(3)---
--------ALFIN1    <---------AHL20(1) ------------>CBF    <---------YAB1   <---------AHL12(3)  ------
------->RAV1(1) <---------TOE2(3)  <-----------GT1     --------->YAB1----------->GT1  <---------MYB52(1)
-DOF2<---------AHL12(2)   <-----------GT1 <---------AHL20(2)<---------AHL12(2)--------->CCA1(1) ----
 
aacacattattattccattaacatatttgttacatttttgaccaatttttttttcttagtataatttttctaaagaaaaaaatatcttcgttttttcaat  5866800
                                                                                         ------->TEIL
                                                                           <---------AHL12(2)
                                  --------->MYB52(1)                      <---------AHL25(3)
                                  ----------->RAV1(1)                     <---------AHL25(2)
                                  ------>MYB46(1)                         <---------AHL12(3)
                                  -------->P                              --------->AHL25(2)
                                 <---------ALFIN1                         <---------AHL12(2)
                                 --------->MYB55(1)                       --------->AHL12(1)
                                <---------MYB111(2)                       <---------AHL12(1)
                                --------->DEAR3(1)                       <---------AHL25(2)
                                --------->MYB46(3)                       --------->AHL12(1)
                         --------->YAB5                                  <---------AHL12(1)
         <---------At5g28300    <---------MYB55(2)                       --------->AHL25(2)
     <---------ZAT6   --------->WOX13(1)                      <---------AHL20(2)         <-------TEIL
--->CBF <-----------GT1 <---------ATHB12   <-----------HVH21 <---------DOF5.7(1)     ---------------
----WOX13(2)    <---------DOF5.7(1)       ----------->GT1<---------YAB5  --------->AHL12(2)
--------YAB1   <---------DOF5.7(1)------>MYB83           <-------TEIL    --------->AHL25(3)
--------->CBF  <----------DOF2 --------->ANAC58       --------->KAN1     <---------AHL25(1)
--->WOX13(2)  <---------DAG2   --------->ANAC58   --------->YAB1         --------->AHL25(1)       --
----->YAB1    <---------DOF5.7(1)--------->ANAC46<---------ATHB12        <---------AHL12(3)     <---
 
tacaatttgtgttacagccttttttcaatcactcacccaccagaaatgtcaaatcatatattcatttttttgtgaaaaaatttgcaactatgtacattca  5866900
                    <------MYB46(1)
                    <------MYB83
                    ----------->GT1
                    <---------MYB46(3)
                   --------->MYB111(2)
                   --------->MYB46(2)
                   <---------AtMYB61
                   --------->MYB55(2)
                   <---------DEAR3(1)
                   --------->MYB111(1)
                   <---------MYB46(3)
                  <---------MYB55(1)
                  <--------P
                 <-------GAMYB
                --------->MYB111(2)
                --------->MYB55(2)
                <---------MYB46(3)
             <------MYB46(1)
             <------MYB83
            --------->MYB55(2)
            --------->MYB111(1)
            <---------MYB46(3)
            <---------DEAR3(1)
            --------->MYB46(2)
            <---------AtMYB61                  <----------DOF2
           <--------P                  --------->ZAT14
           <---------MYB55(1)         <--------P
         --------->ATHB12    --------->ANAC55(2)
         <---------MYB46(3)  <---------ANAC55(2)                                      --------->ALFIN1
<---------YAB1 <---------AtMYB61     <---------MYB52(1)  ----------->HVH21         --------->DAG2
>AtSPL8 <---------YAB1   <---------WOX13(2)    <---------DAG2    <---------ZAT18   --------->DOF5.7(1)
------->YAB1--------->MYB111(2)   <---------ANAC46       <---------YAB1           ---------->DOF2  -
------TOE2(3)<---------MYB46(3)----------->HVH21<---------DOF5.7(1)         <---------ZAT6  --------
 
aggatgatagtatggttggtggttggtgaattatgtgaccggtagactcactttttagttctgactggtgcaatttgtagtcttaaaaagtgggaaggga  5867000
                                                                                --------->YAB1
                                                                                --------->YAB5
                   <-----------GT1                                             --------->ICU4
                <---------AHL12(2)                                           <---------ICU4
                --------->WOX13(2)                                           -------->HAHB4
            --------->ANAC46                                                 --------->YAB1
     <---------AHL12(1)                                                    --------->WOX13(2)
    <---------AHL25(2)                                                ----------->GT1----------->GT1
    --------->AHL20(3)                                               <---------TOE2(3)
    --------->AHL25(2)                                               --------->DOF5.7(1)
    <---------AHL20(3)                   <------MYB46(1)             <---------TOE1(3)<------ZmHOX2a(1)
    <---------AHL12(2)                   ----------->GT1           ---------->DOF2   <----------ID1
    --------->AHL12(2)                   <------MYB83           <---------ZAT6 <---------YAB1
   <---------AHL12(1)                  <---------WOX13(1)  <---------KAN1  --------->AHL12(2)
   --------->AHL12(1)                 <---------RVE1(2)    --------->CCA1(2)<---------ATHB51
--------->YAB1  <---------WOX13(2)   --------->ATHB12     <---------RVE1(2)<---------AHL12(2)
---------->GT1  --------->AHL12(2)  <---------YAB1        --------->ARR11(3)--------->ICU4 <--------
--->GT1<-----------GT1            <----------DOF2        <------ZmHOX2a(1) <---------WOX13(2)     --
 
aaatgaaaattttccacataatttacttcaattttgtctttgattggtgataacaaaataggatatagagtaaaggttaattatgatgaggaaaaaaaca  5867100
                                                                                                <---
                                                                     <---------ANAC58          -----
                                                                     <---------ANAC46         ------
                                           --------->AHL20(2)        <---------ANAC58         <-----
                                         <---------WOX13(2)      <---------MYB52(1)           <-----
                                         --------->WOX13(2)    --------->ATHB12           <-------GAMYB
                                     --------->At5g28300    --------->GATA12             -----------
--ID1   <---------YAB1              ----------->GT1         --------->RVE1(2)            <---------MYB46(3)
------->RVE1(2)                    --------->ZAT6    <---------DOF5.7(1)              --------->ALFIN1
 
aactccaacttatactagcagtcaaaagtatatttcttacagtaaattacatagactctttcaaatccattggcttgttagactagtatgtgtggttatt  5867200
<- Previous    Next ->

AGI:  At5g17770.1   
Description:  ATCBR (NADH:CYTOCHROME B5 REDUCTASE 1). similar to NADH-cytochrome b5 reductase, putative [Arabidopsis thaliana] (TAIR:AT5G20080.1); similar to NADH:cytochrome b5 reductase [Vernicia fordii] (GB:AAV69019.1); contains InterPro domain Flavoprotein pyridine nucleotide cytochrome reductase; (InterPro:IPR001709); contains InterPro domain Oxidoreductase FAD/NAD(P)-binding; (InterPro:IPR001433); contains InterPro domain Oxidoreductase FAD-binding region; (InterPro:IPR008333); contains InterPro domain NADH:cytochrome b5 reductase (CBR); (InterPro:IPR001834)
Range:  from: 5864253    to: 5866711    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.