Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           --------->AHL20(2)             --------->AHL12(3)
 --------->TOE1(1)--------->YAB1          <---------AHL25(2)
<---------LBD16  <---------AHL20(2)       --------->AHL20(3)
<---------HSFB2a(2)  --------->YAB1       <---------AHL20(3)
--------->HSFB2a(2) <---------YAB1      --------->AHL12(2)
------>GLK1(2)<---------AHL20(1)       --------->AHL12(2)                     <----------DOF2
----->GATA12  --------->AHL20(1)      <---------AHL20(2)          <---------KAN1  <----------DOF2
------GLK1(2)<---------AHL12(2) <---------ANAC58 --------->WOX13(2)          <---------DOF5.7(1)
------RVE1(2)--------->AHL12(2) <---------ANAC58 <---------WOX13(2)         ---------->ID1
attctcggactacattatatattatgatatatggttcttgtttattttttttaattgcaggtaactcgaatattgttttgtctttcttttagtgtattgt  198500
                                               --------->AHL12(2)                                <--
                                              <---------AHL25(1)                                 <--
                             --------->ATHB12 <---------AHL20(2)                                 ---
                             -------->ATHB1   --------->AHL12(3)                                 <--
                             --------->ATHB51 <---------AHL12(1)                               -----
                             <---------ICU4   --------->AHL12(1)                               <----
                            --------->ICU4   <---------AHL20(1)                           ----------
                            --------->AHL12(1)<---------AHL12(3)                          <---------ANAC55(2)
                 <---------AHL20(2)          --------->AHL20(1)                          --------->RVE1(2)
           --------->ANAC55(2)               --------->AHL25(3)                         <---------KAN1
           <---------ANAC55(2)              <---------AHL12(3)                       <------ZmHOX2a(1)
      --------->YAB5        <---------YAB5  <---------AHL20(2)                     <---------TOE2(3)
   <----------DOF2          <---------ATHB51--------->AHL12(3)     <-----------GT1 --------->ANAC46
tgttttctttgattacatatttagtttttgaattattgtgtaagtatatatatttttaagaatttgttttttacatcattttttataaggaatatgtaaa  198600
 --------->ANAC46                                                           --------->AHL20(2)
 --------->YAB1                                                             <---------AHL20(2)
 --------->ANAC55(1)                                                        --------->AHL20(3)
 --------->ANAC58                                                           <---------AHL12(3)
 --------->ANAC58                                                          --------->AHL12(3)
 --------->ANAC55(2)                                                       <---------AHL20(2)
-------AHL25(3)                                         --------->RVE1(2)  --------->AHL20(2)
-------AHL20(2)                                      <---------AtLEC2      --------->AHL25(3) ------
------>AHL20(2)                                 <---------ARR14(2)         --------->AHL25(1) <-----
-------AHL25(1)         <---------YAB5          --------->ARR11(2)         <---------AHL25(1) <-----
---->WOX13(2)          --------->RVE1(2)        --------->ARR14(2)       <---------WOX13(2)   <-----
-----WOX13(2)      --------->YAB1               <---------ARR11(2)       --------->WOX13(2)   <-----
->GT1    <---------RVE1(2)                 <-----------HVH21      <------ZmHOX2a(1)       --------->AHL12(3)
ttaaacgtaatagataattctaacataatcaaaccttgttcatacatgtcagaactgcatgtctatataggaatacaattaaattaaaactaaaaatata  198700
                          --------->RVE1(2)      <---------AHL20(1)
                          <---------ARR11(2)     --------->AHL20(1)
                          --------->ARR11(2)     <---------AHL12(1)
                       <---------ANAC58          --------->AHL20(2)
                       --------->ANAC55(2)       <---------AHL20(2)
                       <---------ANAC58          --------->AHL25(2)
                       <---------ANAC55(2)       <---------AHL25(1)
                    <---------RVE1(2)            --------->AHL25(1)
                  <---------YAB1                 --------->AHL20(3)
              <---------AHL12(1)                 --------->AHL25(3)
              --------->AHL25(2)                 --------->AHL12(1)
              <---------AHL20(2)                <---------KAN1
              <---------AHL25(1)   <---------RVE1(1)               <---------AHL12(2)          <----
              <---------AHL25(2)   <---------CCA1(1)             --------->AHL20(2)          -------
--->AHL20(2)  <---------AHL20(3)  <---------RVE1(2)<---------AHL12(2)                        -------
----AHL20(2)  --------->AHL25(1)  <---------ARR14(2)          --------->ATHB12               <------
----AHL12(3)  --------->AHL12(1)  --------->ARR11(3)         <---------YAB5                <--------
----AHL25(1) <---------KAN1 --------->YAB1   <------ZmHOX2a(1)--------->YAB5               ---------
----YAB1     --------->AHL12(1)   <---------ARR11(3)  <---------AHL20(2)           --------->KAN1
aatgccttctcatggaattttttgattcgtatcagaagatatttggcaggaatttattttcttagtgattaaaaaacaaaaaacaaatgttcgaagtatc  198800
        ----------->RAV1(2)                                <---------PCF2
        --------->ZAT2                                     <---------ARR11(2)
        <---------ZAT2                                     <---------ARR14(2)
       --------->MYB52(1)                                  --------->ARR11(2)
 --------->DOF5.7(1)                                       --------->ARR14(2)       <-----------GT1
-----ANAC46              <---------AHL20(2)                <---------GATA12       <---------WOX13(2)
-->MYB52(1)             --------->AHL20(2)                 --------->GATA12    <---------MYB52(1)
-->ARR11(2)             --------->AHL25(3)    <---------MYB52(1)            <------------AtMYB77
---ARR11(2)    --------->ZAT18        <---------YAB5<----------DOF2       --------->MYB52(1)
-HSFC1(2)      <---------ZAT18        <---------YAB1<---------ANAC58<---------ANAC55(2)
>HSFC1(2)    --------->PCF2       <----------DOF2   <---------ANAC58--------->ANAC55(2)           --
ggagaaggcccaactgagcccactagtttaaattgtactttgtgattcccttgggccttgtggatcccattaagtactaactgttatttacaagaatgcc  198900
                                               <---------ARR11(3)          --------->ANAC58
                 <---------AHL12(2)         --------->AHL12(3)             --------->ANAC58
                --------->AHL12(3)          <---------AHL20(3)          --------->LBD16
                --------->AHL12(2)          <---------AHL12(3)         --------->HSFB2a(2)
                <---------AHL12(3)          <---------AHL25(1)         <---------ANAC55(2)
                <---------AHL25(2)          <---------AHL12(2)         <---------HSFB2a(2)
               <---------AHL20(2)           --------->AHL20(3)        <---------LBD16
               --------->AHL20(2)          <---------AHL25(3)       <---------ARR14(2)
            --------->YAB1                 --------->YAB1  <-----------RAV1(2)
          <-----------TBP                *TSS --------->RVE1(1)     --------->ARR14(2)
     --------->ANAC58        --------->WOX13(2)--------->RVE1(2)    <---------ARR11(2)  ============
     --------->ANAC58        <---------WOX13(2)<---------GATA12     --------->GLK1(2)   ------>ZmHOX2a(1)
--------->At4g35610       ------------>CBF--------->AHL20(2)      --------->KAN1  --------->KAN1
------->ATHB12 --------->AHL25(3)<-----------RAV1(1) --------->KAN1<---------GLK1(2)   --------->TOE2(3)
atcatcggaggccatttataaattttggactcaattttgttgcaaataaaaatctgaaattctcaggcgagattccggaagcaaaacattcctaaatttc  199000
        ------>NtERF2                     --------->LBD16
        --------->LBD16                  --------->ANAC55(2)
       --------->ANAC46                  <---------ANAC58                                 --------->TOE2(3)
       --------->ANAC58                  <---------ANAC58                                 --------->TOE1(3)
       --------->ANAC58                  <---------ANAC46                                <---------HSFB2a(1)
      ------>ZmHOX2a(2)                  <---------ANAC55(2)                             --------->HSFC1(2)
    <---------ARR11(2)                <---------ARR11(2)      <---------ARR11(3)         <---------HSFC1(2)
    <---------RVE1(2)                 --------->ARR11(2)      --------->ARR11(3)        ------->TEIL
    --------->ARR11(2)                <---------ARR14(2)--------->ANAC46               <---------ARR14(2)
--------->O2                          --------->ARR14(2)--------->ANAC58          --------->DEAR3(1)
=============HOX2a_HOX2a       --------->At4g35610      --------->ANAC58      ----------->HVH21   <-
gccaagtgatccgccatgggagaagagaagtctctgcttcagttccgtagttttccttcactcaagacctctgatttcgctctcaccgaagaaccttcat  199100
                                                      <---------ANAC58            --------->LBD16
                              <------NtERF2           <---------ANAC58           <---------ANAC58
                       --------->ARR11(2)            <------NtERF2               --------->ANAC55(2)
                       --------->ARR14(2)          <---------DEAR3(1)            <---------ANAC58
                   <------NtERF2    <---------ARR11(2)<---------ANAC46        --------->ARR11(2)   <
               <-----------HVH21   <------ZmHOX2a(1)------>NtERF2             <---------ARR11(2)  <-
             ------->MYC3    --------->LBD16    <---------DEAR3(1)           <----------DOF2 <------ZmHOX2a(1)
             <-------MYC3   --------->DEAR3(1)  --------->ALFIN1       <---------ANAC58      =======
            --------->O2   <---------LBD16  ---------->DOF2 <-----------GT1 <---------DOF5.7(1)   --
--------RAP2.6(2)<---------ANAC46 ----------->GT1  --------->ALFIN1    <---------ANAC58      =======
ggaggctggagaacaacgtgtcgtcgaatcgccggagaggaaacaagagaagcggtggcgtttttaccaattttgcgtccctttccgtagcgattaggag  199200
         <---------KAN1          <---------RAP2.6(1)
        <---------GATA12         <---------RAP2.3(1)
        <-----------ARR10       <---------DEAR3(1)
        --------->GLK1(2)       <---------ATERF1(2)                       --------->LBD16          -
        <---------ARR14(2)      --------->ATERF1(2)                   <---------ARR11(2)           -
        --------->ARR14(2)      <---------RAP2.6(2)                 --------->KAN1                <-
        --------->GATA12        <---------ANAC46                 <---------MYB46(3)              <--
        --------->RVE1(2)       <---------RRTF1(3)              --------->ALFIN1                 ---
       <---------GLK1(2)        <---------RAP2.3(3)             <---------DEAR3(1)              <---
------>ZmHOX2a(2)               <---------DREB2C(2)             <---------AtMYB61              -----
------ZmHOX2a(2)                <---------RRTF1(2)             <---------------------WRI1--------->ARR11(2)
--------GATA12                  <---------RAP2.3(2)       <---------ARR14(2)             --------->ARR14(2)
=======HOX2a_HOX2a   ------->GAMYB<---------At4g35610     --------->ARR11(2)            --------->KAN1
------->GATA12    --------->MYB52(1)<---------ATERF1(1)   --------->ARR14(2)        <------ZmHOX2a(1)
======HOX2a_HOX2a <-----------GT1<---------ORA47(2)       <---------ARR11(2)    --------->DOF5.7(1)-
agatcggagagaatctacatttaacggtcgtaatggcggcggaggcggagcgttcgcatcggtttcggtggtgattccgaaggaagaggatgaattcgcg  199300
                                                           <------NtERF2                 --------->ABI4(2)
                                                           <---------ZAT18               --------->At4g35610
                                                           --------->ZAT14              <---------ARR11(2)
                                                           --------->LBD16              <---------ARR14(2)
                                                           ------>NtERF2                --------->ARR11(2)
                                                          --------->RAP2.3(2)          --------->ATERF1(1)
                                                          --------->DEAR3(1)          <---------ATERF1(1)
                                                          --------->RAP2.6(2)         --------->LBD16
          --------->ZAT2                                 <------NtERF2               --------->DEAR3(1)
          --------->At4g35610                            --------->ATERF1(1)        <---------LBD16
     ------>NtERF2                                       --------->RAP2.3(1)     --------->SPL7(1)
   --------->TOE1(1)                                    ------>NtERF2          <---------SPL7(1)
----->MYB46(1)                                          <---------RAP2.3(1)   <---------ANAC58------
------->P <---------ZAT2                                <---------ATERF1(1)   <---------HSFB2a(1)
--------ALFIN1                                         --------->ANAC58       <---------ANAC58------
-------MYB46(2)                        --------->ETT(2)--------->ANAC46       --------->HSFB2a(1)---
------>DEAR3(1)                        <---------ETT(2)--------->ANAC58    <------NtERF2--------->ARR14(2)
---NtERF2 <---------At4g35610  <----------DOF2         <---------DEAR3(1) --------->LBD16--------->ZAT2
->NtERF2<-----------RAV1(2)   <---------ANAC58      --------->DOF5.7(1)  --------->DEAR3(1)<--------
----->MYB83 <---------MYB46(3)<---------ANAC58    ---------->DOF2       <---------LBD16<------NtERF2
cctacctcggcccagctgttgaaaaaccccattgctttactgtcgatagtaccgaaagacgccgcactattcttcgccggagcgttcgccggagccgccg  199400
<- Previous    Next ->

AGI:  At5g01490.1   
Description:  CAX4 (cation exchanger 4); cation:cation antiporter. Identical to Vacuolar cation/proton exchanger 4 (CAX4) [Arabidopsis Thaliana] (GB:Q945S5;GB:Q9M025); similar to CAX3 (cation exchanger 3), cation:cation antiporter [Arabidopsis thaliana] (TAIR:AT3G51860.1); similar to CAX [Suaeda maritima subsp. salsa] (GB:AAR99078.1); contains InterPro domain Calcium/proton exchanger superfamily (InterPro:IPR004798); contains InterPro domain Calcium/proton exchanger; (InterPro:IPR004713); contains InterPro domain Sodium/calcium exchanger membrane region; (InterPro:IPR004837)
Range:  from: 195540    to: 198523    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At5g01500.1   
Description:  mitochondrial substrate carrier family protein. Identical to Thylakoid ADP,ATP carrier protein, chloroplast precursor (TAAC) [Arabidopsis Thaliana] (GB:Q9M024;GB:Q8LCT8); similar to mitochondrial substrate carrier family protein [Arabidopsis thaliana] (TAIR:AT3G51870.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15815.1); contains InterPro domain Adenine nucleotide translocator 1; (InterPro:IPR002113); contains InterPro domain Mitochondrial substrate carrier; (InterPro:IPR001993); contains InterPro domain Mitochondrial carrier protein; (InterPro:IPR002067)
Range:  from: 198942    to: 201551    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.