Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
             --------->YAB1               --------->TOE2(3)
             --------->ATHB12    ---------->DOF2
             ----------->GT1   <------ZmHOX2a(2)       <------ZmHOX2a(2)
             --------->YAB5   <---------GATA12        <---------ARR11(2)
            --------->ICU4    --------->RVE1(2)       --------->ARR11(2)  --------->YAB1
        <---------KAN1  ----------->HVH21 --------->TOE1(3)               --------->YAB5
  ---------->DOF2--------->KAN1==================================HOX2a_HOX2a                  <-----
<---------ATHB12--------->AHL20(2)      --------->ARR11(3)              --------->RVE1(2)     <-----
-------->RVE1(2)<---------AHL20(2)      <---------ARR11(3)------>ZmHOX2a(1)     ------->GAMYB ------
---->HVH21  <---------YAB5   --------->At4g35610--------->AHL12(1) --------->RVE1(2) <---------MYB52(2)
caaatcaaagaatgaatgattaattctatgacagatcaaagaagaccttaaaaaatcgatcctttcgatatatcaaatcacaactgcaactaaactcata  17342300
                                                 <--------ATHB1         ------>ZmHOX2a(2)
                                                 --------->ATHB51      <------ZmHOX2a(2)
          <---------AHL20(2)                     -------->ATHB1       --------->GATA12
          <---------AHL25(1)                     --------->ATHB12     <---------GATA12
          <---------AHL20(3)                    <---------ATHB12      <---------ARR11(3)
          --------->AHL20(3)                    --------->ICU4        --------->RVE1(2)
   <---------DOF5.7(1)                     --------->ANAC46           --------->ARR14(2)
   <---------DAG2                          --------->ANAC58           --------->ARR11(3)        ----
   <----------DOF2                         --------->ANAC58           <---------ARR14(2)        <---
<---------ALFIN1                      <----------DOF2           --------->YAB5                  ----
----KAN1  --------->AHL12(3)   <---------WOX13(2)<---------ICU4<---------ATHB12                <----
-----TaMYB80                <---------ANAC58    <---------ATHB51--------->YAB1              --------
--->KAN1 --------->YAB1     <---------ANAC58    <---------YAB1--------->RVE1(2)  ---------->DOF2<---
tgcccacttttatattaatcttggtaacatagcttattagactttcacacaataattgaatcccaaatcataagatccctaaaacaaagctataaccaaa  17342400
                             --------->ANAC58           --------->ARR11(3)
----->RVE1(2)           --------->ANAC58          <-------TEIL
------ARR11(3)          --------->ANAC58<----------DOF2 --------->RVE1(2)                     ------
----->ARR11(3)          --------->ANAC46--------->TOE2(3)<------ZmHOX2a(2)                  <-------
-----GLK1(2)        <-----------GT1     <---------------AGL15                              ---------
->TOE2(3)          <---------YAB1 --------->RVE1(2)     <---------ARR11(3) --------->ANAC46<--------
------GATA12  ----------->GT1--------->ANAC58  ----------->GT1   <----------DOF2       --------->YAB1
atctcagaaatgaaaacgcgttattacaagacaagctaatctactttaacaggttcaaagatcgaagactttccttccacataagtagaatcagaaatct  17342500
     --------->YAB5                        <---------ATHB12
    --------->MYB46(3)   ----------->GT1   <<<<<<<<<ARR2                     --------->At4g35610
  --------->MYB52(1)   ---------->DOF2    --------->RVE1(2)          >>>>>>>>>TBF1          --------
--->TOE2(3)      --------->HSFC1(2)       ------------------------>ANAC81    <---------HSFC1(2)
--GATA12         <---------HSFC1(2)  --------->ANAC58             >>>>>>>>>TBF1            <--------
>GLK1(1)         <---------YAB5      --------->ANAC58    <---------KAN1 >>>>>>>>>TBF1  ----------->GT1
-GLK1(1)    <---------------------WRI1   --------->WOX13(1) <---------TOE2(3)--------->HSFC1(2)<----
caaaacaacgactaggtcgaaacatcgaaagttaaacaccaagacaatcaaacaaagagaatgaaggaagaagaagaagaagcttacaagttgttaaatt  17342600
                                                      --------->YAB5             --------->ARR14(2)
                                                <------NtERF2                    <---------ARR14(2)
                                          --------->DOF5.7(1)                  --------->LBD16
                                          --------->DAG2                     <---------LBD16
                                     --------->AHL20(2)  <---------AHL12(1) --------->MYB52(1)
                                     --------->AHL25(1)  --------->AHL12(1) ------>MYB46(1)------>ZmHOX2a(1)
                --------->YAB1      <---------KAN1  <---------WOX13(1)      ------>MYB83   ---------
              --------->RVE1(2)    <---------WOX13(2) --------->ATHB12      -------->P<---------ANAC58
->KAN1   --------->ANAC58   <---------ANAC58  <---------DEAR3(1)           --------->MYB55(1)
-AHL20(2)--------->ANAC58   <---------ANAC58<-----------HVH21             --------->DEAR3(1)
---TEIL  --------->ANAC46<---------KAN1 ---------->DOF2 <---------WOX13(1)<---------MYB46(2)
cgttgcaaaaacacgaaaatcaaaacgaattacgagcgaattaaaaaggtcgccgattgattaatctctctctctcgcctaccggattgtcgtcctctga  17342700
                                     --------->ICU4                                             ----
                                    --------->AHL20(3)                                         -----
                                    <---------AHL12(3)                             --------->YAB5
                                    --------->AHL25(2)                             <--------ATHB1  -
                                    <---------AHL25(2)                             --------->AHL12(1)
                                    <---------AHL12(2)     <---------DOF5.7(1)     <---------AHL12(1)
                                    <---------AHL20(3)    <---------DAG2          <---------KAN1----
                                   --------->YAB1      <---------TOE1(2)          <---------AHL25(1)
                                  <---------ATHB12  --------->YAB1                --------->AHL25(3)
                                  <---------ATHB51 <<<<<<<<<ARR2                  <---------AHL12(1)
                                  --------->ICU4--------->KAN1        --------->At4g35610      -----
   <----------ID1         --------->ATHB12    --------->ANAC58   --------->HSFB2a(2)        <-------
>At4g35610                <---------MYB46(3)  --------->ANAC58<-----------GT1     --------->AHL12(1)
-At4g35610      --------->At4g35610--------->YAB5  <<<<<<<<<ARR1 <---------HSFB2a(2)        --------
-->RAV1(2)      <---------At4g35610*TSS--------->AHL12(2) <----------DOF2    --------->YAB1 --------
agctaaacgacgaagaaacagcagagaaatggttgcaataataataaacacacaatcgtagcttttttctcgacgctgaatcagaataattcaaaaatct  17342800
       <-------GAMYB                                                      --------->AHL25(2)
      <---------MYB46(3)                                                  --------->AHL12(1)
      --------->MYB52(2)                                                  --------->AHL25(3)
    <---------MYB52(1)                                                    <---------AHL25(2)
----->TOE2(1)                                                             <---------AHL25(3)
---------->AtSPL3                                                         <---------AHL12(1)
------>TEIL                             --------->MYB59                   <---------AHL20(1)
----->TOE1(1)          ---------->ID1 <---------MYB52(1)               --------->YAB1    <---------ANAC58
---------->AtSPL8 <---------ZAT2     <-------GAMYB                  ----------->RAV1(1)  <---------ANAC58
--ARR11(3)        --------->ZAT2     <-----------HVH21   --------->RVE1(2)--------->AHL20(1)      --
->ARR11(3) <---------ANAC58   ---------->DOF2            --------->ARR11(3)<---------AHL12(3)   ----
->GLK1(2)  <---------ANAC58<---------WOX13(2)           <---------CCA1(2)--------->AHL25(3)   <-----
cgtacctgtttgttgagttccagcttggcccattaaagcccgttaggcccatttcagttatatctatcttccaacaataaatttggtagtttgcgcgctt  17342900
                                   --------->ZAT2             <---------ANAC58
                           <---------ARR11(3)            --------->ALFIN1
                           --------->ARR11(3)          <---------O2
                           <---------GATA12            <---------TGA1a
             --------->ANAC58      <---------ZAT2      --------->O2
             --------->ANAC46    ================================MYC_MYB
             ------>MYB83 --------->GLK1(1)       ----------------->AGL1                           <
  ----------->GT1   <-----------HVH21             --------->ZAT18<-----------HVH21             <----
------->YAB1 ------>MYB46(1)<------ZmHOX2a(2)     <---------ETT(2)----------->HVH21         <-------
----->AHL20(2)   --------->At4g35610    ----------->GT1--------->TGA1a <---------ANAC55(2)  <-------
-----DOF2    --------->ANAC58    ------->GAMYB    <-----------------AGL1      ------->TEIL ---------
ttaataagttaaaaccaagcagttgtcagagatcaacgagctcgtgtaaaatgtccacaagtgggacttgtgacccgtatgcattttttatgccattttt  17343000
                                 <---------ICU4                                  <---------AHL12(2)
    <---------ANAC55(1)          --------->ATHB12                              <---------AHL20(3)
    <---------ANAC58             --------->YAB1                                --------->AHL20(2)
    <---------ANAC58        <---------ARR11(3)                                 --------->AHL20(3)
    <---------ANAC46        --------->ARR11(3)       --------->At4g35610       --------->AHL25(1)
---------ICU4      --------->ANAC46<---------YAB1   <XXXXXXXXXXXXXXXXXXXXXMIR777 --------->AHL12(2)
-------GT1    --------->RVE1(2) <---------YAB1     --------->YAB1              <---------AHL12(3)
--DOF5.7(1)   --------->GATA12  <---------YAB5    <---------ATHB12        ----------->GT1     ------
--ICU4        --------->ARR14(2)--------->ICU4    <---------YAB5     <---------ANAC46   --------->At4g35610
>ICU4         <---------GATA12  <---------ATHB12  --------->ICU4  --------->ALFIN1  --------->MYB52(1)
actaatttcgtgtaacaaatctacaaaacaagataatcattaatcactacgtaatcatctaaattcaatgtgtggtatagaaaaaaataacagatgagat  17343100
                     <-----------GT1                                         --------->RVE1(1)
                  --------->AHL12(2)                                        --------->AHL12(1)
                  <---------AHL12(2)                                        <---------AHL25(3)
                 <---------AHL12(1)       <---------AHL25(1)                <---------AHL12(1)     -
                 --------->AHL12(1)       <---------AHL12(3)               --------->AHL20(3)      <
               <---------RVE1(2)          <---------AHL20(2)               <---------AHL20(3)   ----
         <---------RVE1(2)               --------->ARR11(3)                <---------AHL25(1) <-----
         --------->ARR11(3)              <---------ARR11(3)           ----------->GT1         ------
         <---------ARR11(3)              <---------AHL20(1)           <----------ID1          ------
         <---------GLK1(2)               --------->AHL25(3)         ---------->DOF2           ------
       <---------TOE1(3)            ----------->GT1               <---------AHL25(3)          ------
       <---------TOE2(3)         --------->YAB1                  --------->AHL20(2)      -----------
--->GATA12   <---------YAB1   ----------->RAV1(1)          ----------->GT1 --------->AHL25(1) ------
ttatgtgtttaagattttgatattttaccaaaacaacaatagtatatatttgtggtatagaattgaaaataaaaagaaaaaaatctaaaaaactgacaag  17343200
<- Previous    Next ->

AGI:  At4g36800.1   
Description:  RCE1 (RUB1 CONJUGATING ENZYME 1); small protein conjugating enzyme. similar to RUB1-conjugating enzyme, putative [Arabidopsis thaliana] (TAIR:AT2G18600.1); similar to RUB1-conjugating enzyme-like protein [Solanum tuberosum] (GB:ABA46772.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17577.1); contains InterPro domain Ubiquitin-conjugating enzyme, E2; (InterPro:IPR000608); contains InterPro domain Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135); contains InterPro domain RUB1 conjugating enzyme Ubc12 (InterPro:IPR015580)
Range:  from: 17340955    to: 17342736    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.