Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          <---------ANAC55(2)                                          --------->TOE2(3)         <--
          --------->ANAC55(2)                                          <----------DOF2           ---
 <-------TEIL--------->RVE1(2)              --------->LBD16            --------->TOE1(3)        <---
>YAB5    <-------TEIL ----------->GT1  --------->GLK1(1)       <---------KAN1                   <---
aacatacagaaatacatatcaagaccagttacaaaacatcagaaacccagaacaaaacttgaaggaacatacaactttaaaaaactgaaacagagaccaa  15178400
---------YAB1                      <---------ANAC46                                               --
-------ICU4                        <---------ANAC58                                   --------->ALFIN1
------>YAB1                   <---------At4g35610                     ----------->RAV1(2)      <----
------ATHB51                <-----------RAV1(2)----------->GT1       --------->MYB52(1)   ----------
------ATHB12    --------->YAB5--------->At4g35610            --------->TOE2(3)        <---------AtMYB61
ttataacagggtttacagacgatgaactgtctcagatggcctgttgagaaaagtaataaacaaaacttaacatacctgataccagagagatggtggtata  15178500
      <---------TOE1(1)                                                     --------->TOE2(3)
    --------->CCA1(2)                                                      <---------ICU4
   <---------RVE1(2)                                           --------->ANAC46     <---------YAB1
------->TOE2(3)                                           <-----------GT1 <---------YAB5           <
-------GT1<------ZmHOX2a(1)                       <-----------GT1 <---------TOE2(2)<---------TOE2(3)
->GT1 <---------TOE2(1)                        ----------->GT1 <---------ALFIN1   --------->YAB1  <-
acctttgatacgaggaaactataccgaaacaagtttcaatacagagtagattgtaacaaaatttccacacaggtttaatccttattgatgatatgcctct  15178600
                          --------->DAG2                      <---------AHL25(1)
                          ------------------------>ANAC81     <---------AHL20(2)
          ----------->GT1--------->DOF5.7(1)                  --------->AHL25(1)
      <---------TOE2(3)  --------->DAG2                       --------->AHL20(2)                 ---
      <---------YAB1    ---------->DOF2                       <---------AHL12(3)                 <--
  <---------WOX13(2)    --------->DOF5.7(1)                   --------->AHL12(3) --------->CCA1(2)
  --------->WOX13(2) --------->ANAC58                  ----------->GT1          <---------ARR11(3)
 --------->YAB5      --------->ANAC46                 --------->ANAC58          --------->ARR11(3)
---------MYB52(1)    --------->ANAC58                 --------->ANAC58      ---------->DOF2   <-----
------GAMYB   --------->KAN1 ----------->GT1     <----------ID1    ----------->GT1     --------->TOE2(3)
cggttgattaagcttgtaaattccaagaaaaggggataaatgaaatcacatggggacaaggaaatataaatagaaaaaaaaaagatataaacttaaactt  15178700
                                        --------->ARR11(2)                        --------->RVE1(2)
                                        --------->RVE1(2)                         <---------ARR11(3)
                                       --------->RVE1(1)                    --------->ANAC58
                                  --------->YAB1    <---------KAN4(1)       --------->ANAC58     <--
                           ----------->GT1 --------->TOE1(3)             *TSS------------>CBF    <--
                         ---------->DOF2--------->ARR11(3)             <------MYB46(1)    <---------
                     --------->ANAC58  --------->CCA1(1)      <---------REM1(2)   --------->ARR11(3)
                     --------->ANAC58  --------->KAN1--------->KAN4(2) <------MYB83 >>>>>>>>>RAP2.2-
------>WOX13(2)   ------------------------>ANAC81   <----------TaMYB80--------->MYB46(2)--------->ANAC58
-------WOX13(2) <----------ID1  --------->RVE1(2)  ---------->TaMYB80 --------->MYB59   --------->ANAC58
-----DOF2    ---------->DOF2   --------->WOX13(1)  <---------KAN4(2)<---------MYB52(1)---------->DOF2
tattgaagtctctctcaaaagaacaagtaaaagtaaatcaaaatatcctcaaagaatataccatctacaaggttaggttacccaatatctaaagcaacaa  15178800
            <---------AHL20(2)         --------->ANAC46
            --------->AHL12(3)       <---------ALFIN1                                              <
           --------->AHL20(2)        --------->ZAT6                --------->ANAC46            <----
           --------->AHL25(1) --------->RVE1(2)                    --------->ANAC58  --------->KAN1-
           --------->AHL25(3)<---------CCA1(2)                     --------->ANAC58 <---------ARR11(3)
-------ANAC58  --------->AHL20(3)   --------->ZAT14  --------->ZAT18                --------->ARR11(3)
-------ANAC58<---------AHL12(2) --------->TOE2(3)--------->DAG2    <---------ANAC55(2)         <----
-ID1    --------->YAB5     <---------ANAC58     ---------->DOF2    --------->ANAC55(2)    <---------
---------->GT1 --------->AHL20(2)   <---------ZAT14  <---------ZAT18            ---------->DOF2<----
gcttgtgaaaaccattaattttatattcttgcttatctcaacactgcatcagaaagtggacaagttgaatacgaaatggacataaaagacattcttttgc  15178900
                          --------->AHL25(3)                       --------->RVE1(2)
    --------->YAB5        --------->AHL20(3)                     --------->AHL12(1)
---------HSFB2a(2)        --------->AHL20(2)                     <---------AHL12(1)
-----ANAC58              --------->WOX13(2)                 ----------->GT1
-------->HSFB2a(2)   --------->ANAC46                     ----------->GT1
-----ANAC46          --------->ANAC58                    --------->DAG2           ---------->DOF2
-DOF2     ---------->DOF2<---------WOX13(2)             ---------->DOF2      <----------ID1        <
-----ANAC58          --------->ANAC58              --------->At4g35610    ---------->DOF2     <-----
gtctagatgataccaaagtatggcacgaaattaatattcacaaaatggggaaatagctgaaaagtgaaaaaatcaacaaaagaacaaaagcttgaagctt  15179000
          --------->ARR11(2)                                              --------->DAG2
          <---------ARR11(2)                                     --------->AHL12(2)
          --------->RVE1(2)                                     --------->AHL20(2)
          --------->ARR14(2)                               ------------>CBF----------->GT1
       --------->YAB1                               <-----------GT1      ---------->DOF2
      <---------YAB5                             <---------AHL12(2)    <---------AHL25(3)
      <---------ATHB12                           --------->AHL12(2)   --------->AHL20(2)    ------>MYB83
    --------->WOX13(1)                          <---------AHL25(3)  <---------AHL12(2)      ------>MYB46(1)
---------YAB5----------->GT1                   <---------KAN1   --------->YAB1  --------->ICU4
-----DOF2<---------CCA1(2) ----------->GT1     --------->AHL20(2)<---------AHL12(2)<---------YAB1 --
tactcatcaatcatatctgttaaaactagggggaaaaaaactgaatgcgaataaataaccctggcaataaaaaataaaaagtaattctcattacctacaa  15179100
                           <---------TOE2(3)                <---------ZAT6         --------->ANAC46
        ------->TEIL       --------->ANAC58           --------->ZAT6            <-------TEIL
     --------->ANAC58  --------->RVE1(2)           <---------KAN1              --------->CCA1(2)
     --------->ANAC58  --------->ARR11(3)        --------->YAB1  --------->DOF5.7(1)   <----------DOF2
-------->DOF2     --------->MYB46(3) *TSS --------->At4g35610  ---------->DOF2<---------RVE1(2)
acaaagacacgaacttgatcaacaaatatcaaggaaacgagaattagatgaagaataagactagtggaaagaccagagagagatacaggcctttcaatgg  15179200
                                                                   --------->O2   --------->KAN1
                                                                   <---------O2   --------->ZAT6
                                                       --------->YAB5       <---------ARR11(3)
                               --------->ARR11(3)      --------->ZAT6       <---------GATA12
                          --------->YAB1            --------->AtMYB61       --------->GATA12
                     ------>ZmHOX2a(1)        --------->YAB5       --------->ANAC55(1)           <--
                --------->GLK1(1)             --------->YAB1       <---------ANAC55(2)     <--------
                <---------GLK1(1)            <---------YAB1       <-----------------------TaNAC69(2)
     <---------ANAC55(2)<-----------HVH21  --------->YAB5      <-----------HVH21  <---------ALFIN1
aagctattacatgagtgagaactcctcagtcatagctcttgaagaacgatgatcaccatcactagcagtcacgtatgaagatcgaacactctcttgacct  15179300
<- Previous    Next ->

AGI:  At4g31240.1   
Description:  electron carrier. similar to DC1 domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G60420.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43974.1); contains InterPro domain C1-like (InterPro:IPR011424); contains InterPro domain Thioredoxin-like fold (InterPro:IPR012336); contains InterPro domain Thioredoxin-like; (InterPro:IPR011594); contains InterPro domain Thioredoxin fold (InterPro:IPR012335)
Range:  from: 15176461    to: 15178774    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g31250.1   
Description:  leucine-rich repeat transmembrane protein kinase, putative. similar to leucine-rich repeat transmembrane protein kinase, putative [Arabidopsis thaliana] (TAIR:AT3G20190.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43973.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Leucine-rich repeat, N-terminal (InterPro:IPR013210); contains InterPro domain Leucine-rich repeat; (InterPro:IPR001611); contains InterPro domain Tyrosine protein kin
Range:  from: 15178931    to: 15181757    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g31248.1   
Description:  other RNA
Range:  from: 15179138    to: 15180809    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.