Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                   <---------KAN1
                                                                               --------->DEAR3(1)
                                                                              <------NtERF2
                                                                             ------>NtERF2
                                                                             <---------ATERF1(1)
                                                                            <---------ALFIN1
                                                                            --------->DEAR3(1)
                                                                           --------->ATERF1(1)
                          --------->ICU4                                  <---------ATERF1(1)
                         --------->WOX13(2)                               ------>NtERF2
                         <---------WOX13(2)       --------->DOF5.7(1)    <---------bZIP60(1)
            ----------->GT1                 --------->RVE1(2)            <---------ETT(2)
           <---------TOE1(3)     <---------KAN1 ---------->DOF2          --------->ETT(2) ------>MYB46(1)
           <---------TOE2(3) <---------TOE2(3)--------->YAB1             --------->bZIP60(1)   -----
       <----------DOF2--------->At5g28300  --------->YAB1             <-----------RAV1(1) -------->P
     ------->TEIL    ----------->GT1    --------->ANAC46     <---------YAB1<------NtERF2  ------>MYB83
 
ggtccatgaactttgaggtatatacagtaattagggataatacccataatcaaaagacaagtttatgacaaaaatgtcgccaccgcatttaccaacaagt  12589600
                                                        <---------ZAT6
                                                        ----------->GT1
                                                    <---------MYB52(1)
                                                  ------>ZmHOX2a(2)                           ------
                                                <---------ARR14(2)                            <-----
                                                <---------ARR11(2)                     ----------->GT1
             --------->DOF5.7(1)                --------->ARR11(2)                     <---------ANAC46
     ----------->GT1    <---------YAB1          --------->ARR14(2)                   <-----------HVH21
    ----------->GT1     <---------RVE1(2)       --------->GATA12                 --------->MYB52(1)
---->KAN1    ---------->DOF2                    <---------GATA12                --------->DOF5.7(1)
 
attccaagagttaaaaaaaagtctattgctattgtctcagacatcaaactggatcggtagtgtaaactatgtctatatgaacaaaaacggtcgtataaag  12589700
                                                    --------->ANAC58
                                                    --------->ANAC46
                                              <---------MYB46(3)
                                              <------MYB46(1)
                                              <---------DEAR3(2)            --------->ANAC58
         --------->ANAC58                     <------MYB83            --------->ARR11(3)
         --------->ANAC58                    --------->MYB111(1)      <---------GATA12
         -------->P                          <---------AtMYB61        --------->RVE1(2)
       --------->MYB46(3)                   <--------P          --------->TOE2(3)
     --------->ANAC58               <----------DOF2 --------->ANAC58 <---------GLK1(2)
     --------->ANAC58              <---------DOF5.7(1)--------->ANAC46<---------ARR11(3) --------->LBD16
--------->HSFB2a(2)         <---------ICU4 <-------GAMYB      ------->TEIL  --------->ANAC58   <----
<---------HSFB2a(2)        <---------YAB1 --------->ATHB12--------------->AtSPL8        <---------ANAC58
>>>>>>>ZML2                <---------YAB5 <---------MYB46(3)  --------->SPL7(1)         <---------ANAC46
--->DOF5.7(1)            --------->YAB1<---------ANAC58   --------------->AtSPL3        <---------ANAC58
----TOE2(3)              <---------ICU4<---------ANAC58   <---------------AtSPL3       ------>ZmHOX2a(2)
 
gttctagcaaacaacccatcaaataccatcatcatttctctttcttggttggttcacccaaaacgtacctcaaaatctcaagctaagtgatccgtggcat  12589800
                          <---------ZAT6
                     <----------DOF2
                 <---------ZAT18      <---------ARR11(3)
             --------->ALFIN1    --------->ALFIN1                  <---------ANAC58
             <---------AtMYB61--------->DAG2                       <---------ANAC58              <--
-----KAN1  --------->CCA1(2) ---------->DOF2                     <---------YAB5         <-----------RAV1(1)
 
ttgagaggtttaagagatggtgggctttagtgaaaagtgtagatgtttctcaccacaagtctctagtaatgggtgtcaaactcacaaacacttgttggcc  12589900
                                       <---------TCP11(2)
                                       --------->PCF2
                                      <---------ANAC46                     <---------DOF5.7(1)
                                      <---------PCF2                   ------>MYB83
                           --------->HSFC1(2)                          ------>MYB46(1)
                       --------->ANAC46<---------PCF5                <---------DOF5.7(1)
                      <---------HSFC1(1)                             --------->AtMYB61           *TSS
                      --------->HSFB2a(2)  ------------>CBF         --------->ZAT2              ----
                      <---------HSFB2a(2)--------->ZAT18          <---------ALFIN1              ----
                      --------->HSFC1(1)--------->TCP16(2) <----------DOF2------>ZmHOX2a(1)     <---
          XXXXXXXXXXXXXXXXXXXX>MIR774B*<---------TCP16(1) <---------DOF5.7(1)          ------>NtERF2
----------CBF<---------DOF5.7(1)   --------->ALFIN1      <---------DOF5.7(1) <---------CCA1(2) <----
 
tattgaagcccatccatcttctcttctcgaaacttcaagtggggtccacaatttctctccctctttctcccaccttcctcttatcttctctgccttctat  12590000
                                                                       <----------DOF2
           <----------DOF2                                            --------->TOE1(3)
         <---------TOE1(2)                                            --------->TOE2(3)
        ------>ZmHOX2a(1)                     --------->ZAT14     --------->DOF5.7(2)
     ------>ZmHOX2a(1)        <---------At4g35610      --------->At4g35610
----->ARR11(3)                --------->At4g35610      <---------At4g35610                       ---
----->RVE1(2)             <-----------GT1     <---------ZAT18     <---------MYB52(1)  <---------ANAC58
------ARR11(3)    --------->STY1(1)        --------------------->WRI1 <---------DOF5.7(1)    -------
-----CCA1(2)     <---------MYB52(1)       <---------DOF5.7(1)    <-------GAMYB        <---------ANAC58
 
atctcttcctcctactttcccttagggtttttcagcttcaaaccctccttgcactctccgcttccctccgttacctttacttctctattgcttagctcga  12590100
                          ------->MYC2
                    --------->ARR11(2)
                    --------->ARR14(2)
                    <---------ARR11(2)
                    --------->RVE1(2)
                    <---------GATA12        --------->ARR14(1)                                   ---
                    --------->GATA12       <---------RVE1(2)                                   <----
               <------NtERF2               <---------GATA12                                    <----
              ------>NtERF2                --------->GATA12                                   ------
             --------->RAP2.3(3)           <---------ARR11(2)                              ---------
             --------->RAP2.6(2)     <---------ARR14(2)                                   <------NtERF2
             --------->ATERF1(2)     <---------ARR11(2)                                   <---------SPL7(1)
             ------->GAMYB<-------MYC2     --------->ARR11(2)                             --------->At5g28300
             --------->RAP2.3(2)     --------->ARR14(2)                                  <---------DEAR3(2)
             --------->DEAR3(1)     <------NtERF2                                       <-----------
            --------->ERF1<-------MYC3     <---------ARR14(2)                        --------->DAG2
            --------->RAP2.3(1)    --------->LBD16                                   --------->DOF5.7(1)
            --------->ATERF1(1)  <------NtERF2                                      --------->DOF5.7(1)
            --------->DEAR3(2)   <---------LBD16                                   ---------->DOF2
            --------->MYB46(3)   --------->At4g35610       <<<<<<<<<TBF1        --------->YAB1<-----
           --------->At4g35610 <---------DEAR3(1)       <<<<<<<<<TBF1     --------->TOE2(3)<--------
     --------->At4g35610  ------->MYC3     <---------GLK1(2)            <---------GATA12------------
------>DOF5.7(1)    <---------ARR14(2)     --------->ARR14(2)          --------->GLK1(1)------------
---->GT1   <---------At4g35610<---------HSFB2a(2)    <<<<<<<<<TBF1     <---------GLK1(1)<---------DEAR3(1)
 
aaaatggcatcttcagccgcccaaatccacgttctcggcggaattggattcgcttcttcttcttcttccaagagaaatctcaatggtaaaggcggtacct  12590200
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                           ---------
                                                                                           ------>NtERF2
                                                                                          <---------DEAR3(1)
                                                                                         <------NtERF2
                                                                                         --------->ATERF1(1)
                                                                                         --------->DEAR4(2)
                                                                                         --------->RAP2.3(1)
                                                                                        <---------RRTF1(1)
                                                                                        <---------RAP2.6(1)
                                                                                        <---------ATERF1(1)
                                                                                        ------>NtERF2
                                                                                        <---------ERF1
                                                                                        <---------ORA47(2)
                                                                                        <---------RAP2.3(1)
                                                                                        <---------DEAR4(2)
                                                                                       <---------RAP2.3(2)
                                                                                       <---------RAP2.3(3)
                                                                                       <---------RRTF1(3)
                                                                                       --------->ATERF1(2)
                                                                                       <---------RRTF1(2)
                                                                                       <---------ATERF1(2)
                                                                                       --------->ALFIN1
                                                                                       <---------DEAR3(1)
                                                                                      --------->ATERF1(1)
                                                                                      <------NtERF2<
                                                                                      <---------ABI4(1)
                                                                                      --------->DREB2C(1)
                                                                                      --------->DEAR4(2)
                                                                                      <---------At4g35610
                                                                                      --------->At4g35610
                                                                                     <---------RAP2.6(1)
                                                                                     ------>NtERF2 <
                                                                                     <---------ATERF1(1)
                                                                                     <---------RRTF1(1)
                                                                                     <---------DEAR4(2)
                                                                                     <---------ORA47(2)
                                                                                     <---------RAP2.3(1)
                                                                                     <---------ERF1<
                                                                                    <---------RAP2.3(3)
                                                                                    <---------RRTF1(2)
                                                  ==================bZIP_DOF        <---------DREB2C(2)
                                                 ------>MYB83                       <---------RRTF1(3)
                                    <----------DOF2                                 <---------RAP2.6(2)
                                    ========================bZIP_DOF                <---------RAP2.3(2)
   ------>NtERF2                    ------>ZmHOX2a(1)    <---------DOF5.7(1)        <---------DEAR3(1)
------>KAN1                        <---------DOF5.7(1)   <---------DAG2             <---------ANAC46
-----DAG2                       <---------MYB52(1)--------->TGA1a                   <---------ATERF1(2)
------DOF2                  --------->MYB52(1)   ------>MYB46(1)                    --------->ATERF1(2)
--->TOE2(3)                --------->ARR11(2)   <---------ALFIN1              --------->ARR14(2)   -
>ARR11(2)                  <---------ARR14(2)  --------->MYB46(3)             <---------ARR14(2)----
----AtSPL3                 --------->ARR14(2) --------->ANAC58            --------->At4g35610   <---
----DOF5.7(1)              <---------ARR11(2) --------->ANAC58            ----------------->AGL3----
-ARR11(2)                --------->ANAC58   <---------ALFIN1              <------NtERF2--------->DEAR3(1)
--->AtSPL3               --------->ANAC58 <---------ALFIN1             --------->ZAT18--------->RAP2.3(1)
--->AtSPL8 ----------------->AGL1 <---------DOF5.7(1)    <----------DOF2 ----------->RAV1(1) <------
 
ttatgccgagaagtgccttcttcggtacaagaaccggtcctttctccacacccacttctgcttttctcagaatgggcaccagaaatggcggcggcgcttc  12590300
            <---------LBD16
          <---------SPL7(1)
         <------MYB46(1)
         <------MYB83
         <---------DEAR3(2)
         <---------MYB46(3)
       <---------MYB55(1)
       <---------MYB52(1)
       <--------P
      <-------GAMYB
     <---------MYB46(3)
    -------------->OsCBT
   <---------LBD16
 <-------TEIL
--------->KAN1
--------->CCA1(2)
--------->ARR14(1)      <-------GAMYB                  <---------SPL7(1)
-------->ARR11(2)      <---------MYB46(3)             <---------ANAC58
---------ARR14(2) <---------ANAC46                    <---------ANAC58
-------->ARR14(2) <---------ANAC58                   <---------------AtSPL8
>ABI4(2)<---------AtMYB61--------->DOF5.7(2)         <---------------AtSPL3
---------ARR11(2) <---------ANAC58               <---------RVE1(2)
---------GLK1(2)--------->ARR11(2)     <-------GAMYB --------------->AtSPL8                      ---
---------RVE1(2)<---------ARR14(2)    --------->MYB111(2)            <---------ZAT14             ---
-------->ARR11(1)<-------TEIL         --------->MYB111(1)            --------->ZAT14        <-------
----->HSFC1(1)  <---------ARR11(2)    --------->MYB55(2)      <---------KAN1            <------ZmHOX2a(1)
------HSFB2a(2) --------->ARR14(2)    <---------MYB46(3) --------->SPL7(1) <---------At4g35610------
----->HSFB2a(2)<---------MYB52(1)  ------------>MYB.PH3(2) --------->YAB5  --------->At4g35610------
----DOF2<---------MYB46(3) <---------DOF5.7(2)  --------->ATHB12 --------->ZAT6        --------->DOF5.7(1)
 
tagatacgcggttggtccggttcgtgtggttaacgagaaggttgttggaattgatttgggtacgactaactctgcagtagctgctatggaaggaggtaag  12590400
                                 --------->ANAC58
                                 --------->ANAC58
                         <---------At4g35610    <---------ANAC58
         <---------MYB52(2) <------ZmHOX2a(1)   <---------ANAC58
    <---------KAN1       --------->At4g35610 <---------RAP2.6(2)                                  <-
  >>>>>>>>>ARR1        <-----------RAV1(2) <-----------RAV1(1)                                    <-
<---------YAB1         =============================RAV                  <---------MYB46(3)      ---
------>TOE1(2)         ================================RAV             <---------ANAC58          ---
------>TOE2(2)         <---------WRKY12  <-------GAMYB            <---------RVE1(2)       --------->DOF5.7(1)
-P>>>>>>>>>ARR2      <-----------HVH21  <-----------RAV1(1)  --------->ALFIN1      <---------ARR14(2)
--->ANAC58  <---------TOE2(3) <---------WRKY38(1)     --------->ANAC46 <---------ANAC58<---------ANAC46
--->ANAC58 --------->MYB52(1) <---------WRKY12  <---------ANAC46<---------YAB1     <---------GATA12
 
cctacgattgtgactaacgctgaaggtcagaggacaacgccttctgttgtggcttacacgaagagtggtgataggcttgttgggcagattgcgaagaggc  12590500
<- Previous    Next ->

AGI:  At4g24280.1   
Description:  CPHSC70-1 (chloroplast heat shock protein 70-1); ATP binding / unfolded protein binding. similar to MTHSC70-1 (mitochondrial heat shock protein 70-1), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT4G37910.1); similar to mtHSC70-2 (HEAT SHOCK PROTEIN 70), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT5G09590.1); similar to cpHSC70-2 (HEAT SHOCK PROTEIN 70-7), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT5G49910.1); similar to heat shock protein 70 [Cucumis sativus] (GB:CAA52149.1); similar to heat shock 70 protein [Spinacia oleracea] (GB:AAB91471.1); similar to chloroplas
Range:  from: 12589998    to: 12593640    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.