Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         <---------MYB52(1)
                                                         ----------->HVH21
                                                        --------->LBD16
                                                        --------->At5g28300
                                                       =================bZIP_DOF
                                                       <---------O2
                                                       ==========================MYC_MYB       <----
                                                       --------->O2                            -----
                                                       --------->TGA1a                        <-----
                   <---------AHL20(2)                  <---------TGA1a  <--------P          --------
                   --------->AHL20(2)                  =====================================MYC_MYB
              <-------TEIL                            <------NtERF2   <------MYB46(1)       --------
            <-------PIF5                             <------NtERF2    <------MYB83        --------->AHL25(2)
            ------->MYC2                             ------>NtERF2   <---------MYB46(3)   --------->AHL20(3)
            <-------MYC4                            --------->ANAC58 --------->MYB111(2)  <---------AHL25(2)
            <-------MYC3                            --------->ANAC46 --------->MYB46(2)   <---------AHL20(3)
            <-------MYC2                  <---------MYB46(3) <----------DOF2        ----------->GT1
       <---------KAN1              ==============================bZIP_DOF          ----------->GT1
--ANAC58    ------->PIF5           <----------DOF2  --------->ANAC58 --------->MYB59<-------GAMYB
--ANAC46    ------->MYC3      <---------At5g28300 --------->ATERF1(1)--------->MYB111(1)<---------YAB1
--ANAC58  ------->TEIL       <-----------GT1 <---------REM1(1)       <---------AtMYB61 --------->AHL20(2)
 
agtttttggaatgcacgttcatataaatgattttacagcttttagttgttgtagcccgccgtgacttttggtttggtagtttatgtctgttaaaattata  11572400
                                                                     <---------ANAC58
                                                                     <---------ANAC58
                                                                    --------->ATHB12
                                                                  <---------WOX13(1)
                                                                  <--------P
                     <---------ARR14(2)                  <---------ANAC46
     <---------At4g35610                                 <---------ANAC58                     <-----
   <---------DOF5.7(1)    <-----------HVH21         --------->MYB52(2)                <------MYB83
  <----------DOF2    --------->ARR14(2)             <---------MYB46(3)<---------WOX13(1)     <------
-----AHL20(2)        <---------GATA12               <-----------RAV1(1)               ----------->GT1
---->AHL20(2)        --------->ARR11(3)          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<------MYB46(1)
----YAB1             --------->GLK1(2)         <---------TOE2(3) <-------GAMYB       --------->MYB46(2)
->YAB1  <---------At4g35610                   <-----------GT1   <---------MYB46(3)   --------->MYB59
->AHL20(2)   <----------DOF2             ----------->GT1 <---------ANAC58        <---------YAB1  ---
 
aattgctcttctgctactttgaaaaatctggtcagtagtacaagaggtttaacatttgttgcgtcgatggttgattgttatgttatgtttggtaaaaaat  11572500
                                                                ----------->GT1
                                                           --------->ICU4
                         <---------YAB1                    <---------ATHB12
                       --------->KAN1                      <---------YAB1
       <---------DOF5.7(1)  <----------DOF2 --------->GATA12--------->ATHB12
----AHL12(2)         <---------DAG2        --------->REM1(1)<---------ICU4
---AHL12(2)          <----------DOF2<---------At4g35610    <---------YAB5           --------->TOE2(3)
------>MYB52(1)     --------->TOE2(3)  <-----------HVH21------>ZmHOX2a(1)      <----------DOF2
 
aaacgaatgctcttctccagtttcctttatgcttttgtcaactgttacatcttcttctcctaatgatttgtatatacttaagcttttccataaaactaag  11572600
                                                                       --------->WOX13(2)
                                                                     <---------AHL20(2)
                                                                     <---------AHL25(1)
                                                                     --------->AHL20(3)
                                                                     <---------AHL20(3)
                                                                     --------->AHL25(1)
                                                                     --------->AHL20(2)
                                                                     --------->AHL25(2)
                                                                     <---------AHL25(3)
                                                                     <---------AHL25(2)
                                                                    <---------AHL25(1)
                                                                    --------->AHL25(1)
                                                                    --------->AHL25(3)
                                                                    <---------AHL20(2)
                                          --------->DOF5.7(1)    -------->HAHB4
                                         --------->DOF5.7(1)     --------->YAB5
                                   --------->ANAC46              ----------->GT1
                 --------->ANAC58  --------->ANAC58              --------->ATHB12
                 <---------ANAC55(2)     --------->DAG2         <---------YAB1
                 --------->ANAC58  --------->AtLEC2             --------->ICU4  --------->ATHB12
                 --------->ANAC55(2)    ---------->DOF2     --------->AHL20(2)  <--------HAHB4
                 --------->ANAC46  --------->ANAC58       --------->TOE2(3)    <---------YAB5
       ---------->DOF2         >>>>>>>>>MYB2           ----------->RAV1(1)    --------->GLK1(2)
   <---------ZAT14  ---------->DOF2------>MYB83       --------->ANAC46 <---------WOX13(2)
   --------->ZAT14--------->TOE2(3)------>MYB46(1)  --------->ANAC46--------->AHL20(2)<---------AtLEC2
 
tcccagtgaagaaagaaactacgtaaaccgagaaaaccaagcaaaaagagggtttacacaacataaaatgattaaattgagaatcatttgcattacctcg  11572700
                                                                      <---------AHL25(1)
                                                                      <---------AHL12(3)
                                                                      --------->AHL20(2)
                                                                      <---------AHL20(2)
                                                                      <---------AHL20(3)
                                                                    <---------AHL12(2)
                                                                    <-----------TBP
                                                                --------->AHL12(3)
                                                                --------->YAB1
                                                                --------->AHL20(3)
                                            <---------------AGL15   <---------AHL12(3)
                                           ----------------->AGL1   --------->AHL12(3)
                                           ----------------->AG --------->AHL20(2)
                                           <-----------------AGL1  <---------ICU4
                                           <-----------------AGL2 --------->AHL12(1)
                                           ----------------->AGL3 <---------AHL12(1)
                                           <-----------------AGL3<---------TOE2(3)
                                   <---------MYB59           --------->TOE2(3)
                     <------------CBF      ----------------->AGL2<---------AHL12(2)    ----------->HVH21
                    --------->ATHB12  <---------GLK1(2)--------->At4g35610        <-----------GT1
                <-----------GT1   <---------At4g35610  <---------At4g35610    <---------RVE1(2)
          ----------->GT1   <---------ANAC46--------------->AGL15--------->AHL12(2)<---------At5g28300
 
gtattacatgggctggaaataacttattgggccttggacctgattttccaaaaatggtcgctcacattaatatttatatgtgattttacagtgacaactc  11572800
                                            <----------DOF2                                        <
                                           <---------DOF5.7(1)                           <---------LBD16
                                         --------->ARR11(3)                         <---------DOF5.7(1)
                                         <---------ARR11(3)                   <---------------------
                                  ------>NtERF2                          <---------RVE1(2)<---------HSFB2a(2)
                   --------------------->WRI1                            <---------GLK1(2)--------->HSFB2a(2)
 *TSS           <------------------------ANAC81                     ------>ZmHOX2a(1)<----------DOF2
 
cacaaatcagccctaactctgtttttgttttcttcgacgactgaggtcttttctctctcgctctcgtcttcctcttgattctcttcttcttttctggagt  11572900
                                                               --------->GATA12
                                                               <---------GATA12
                                                               <---------ARR11(2)
                                                        --------->KAN1
                                                      --------->KAN1
                                                      --------->GLK1(1)
                              <---------AHL12(2)     <---------ARR14(2)
                              --------->AHL25(2)     <---------ARR11(2)
                              <---------AHL25(2)     --------->ARR11(2)
                              --------->AHL12(1) --------->At4g35610 ------->MYC3
                              <---------AHL20(3) <---------At4g35610 <-------MYC3             <-----
                         ----------->GT1       <---------ZAT14 --------->ARR11(2)           <-------
    <----------DOF2   ----------->TGA1        <---------ANAC58 --------->RVE1(2)            --------
    <---------DOF5.7(1)--------->YAB5         <---------ANAC58 <---------ARR14(2)          <--------
    <---------DAG2  <---------ICU4       ------->TEIL<---------RVE1(2)     <---------YAB1--------->YAB1
---------At4g35610 --------->ICU4   <---------AtLEC2 --------->ARR14(2)  <-----------GT1--------->AHL12(1)
---ANAC81     ----------->GT1<---------AHL12(1)--------->ZAT18 --------->ARR14(2)       <---------AHL12(1)
 
ttcgctgcttttttagcctgtaaaaatgacgaaaattttgtatgaatttgtgtgctgatatgctcgaatccacatgttacgcttgtgttgaataatcata  11573000
                                           --------->YAB1
                                        --------->WOX13(1)      <---------ANAC46
                                     --------->RVE1(2)       --------->HSFB2a(2)
  <------MYB83                       --------->ARR11(3)      <---------HSFB2a(2)
  <------MYB46(1)                    <---------ARR11(3)     <---------LBD16
----CCA1(2)                --------->WOX13(2)       <-----------GT1
--ICU4      <---------ATHB12         --------->GLK1(2)--------->ANAC55(2)
->YAB1      <---------KAN1 <---------WOX13(2)     <----------DOF2 <---------KAN1                   <
-YAB5      --------->RVE1(2)  <-----------GT1    <---------DOF5.7(1)                  ----------->HVH21
 
tcatttggttatcgaatcaattctagttccaatttacaaaaatctatcaaactctttacgttttctggagtatgttgagcttgaaactagtgacatagat  11573100
                                                   <---------YAB1
                                                   <---------YAB5
                                               <----------DOF2
                                        <---------GLK1(2)
                                        <---------ARR11(2)                               <---------RVE1(2)
                                        --------->GATA12                                 <---------GLK1(2)
                                        <---------RVE1(2)                                --------->ARR11(3)
    --------->AHL20(2)                  --------->ARR14(2)                               <---------ARR11(3)
   --------->AHL20(2)                   --------->ARR11(2)      <----------DOF2        <---------YAB5
 --------->TOE2(3)          ----------->GT1   <---------DOF5.7(1)     <----------DOF2---------->DOF2
--------->YAB5          <---------TOE2(3) <-------TEIL   <----------DOF2            <---------AHL20(2)
---------YAB5      ----------->GT1      <---------ARR14(2) --------->KAN1      <---------RVE1(2)
 
gaaacattaaaaaaacatggaattgttaagtttgtgaaaattggattcgtctttgtgattctttattctttgtctttgctgtgatatataaagattttgt  11573200
                                                       <---------At4g35610
                                               --------->ATHB12                --------->ANAC58
                                              --------->ICU4                   --------->ANAC58
                                              <---------YAB1                  --------->DAG2
                                   --------------->AGL15                --------->ANAC58
                                   <---------------AGL15                --------->ANAC58
                                  <-----------------AGL2                --------->ANAC46      ------
                                  <-----------------AG --------->At4g35610   --------->DOF5.7(1) <--
              <---------RVE1(2)   <-----------------AGL3         <-------TEIL---------->DOF2  <-----
 
atagaacaacaatttgggagatggagacactgaaattgctgtatttgggattattggcagataaaagattcatacaagaaaaaagcaaatttcgccactg  11573300
<- Previous    Next ->

AGI:  At4g21790.1   
Description:  TOM1 (TOBAMOVIRUS MULTIPLICATION 1). similar to TOM3 (tobamovirus multiplication protein 3) [Arabidopsis thaliana] (TAIR:AT2G02180.1); similar to tobamovirus multiplication 1 [Nicotiana tabacum] (GB:BAE43836.1); contains InterPro domain Protein of unknown function DUF1084 (InterPro:IPR009457)
Range:  from: 11569777    to: 11572561    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g21800.1   
Description:  QQT2 (QUATRE-QUART2); ATP binding. similar to EMB1705/QQT1 (QUATRE-QUART1) [Arabidopsis thaliana] (TAIR:AT5G22370.2); similar to EMB1705/QQT1 (QUATRE-QUART1), ATP binding [Arabidopsis thaliana] (TAIR:AT5G22370.1); similar to ATP-binding family protein [Arabidopsis thaliana] (TAIR:AT4G12790.4); similar to unnamed protein product [Vitis vinifera] (GB:CAO44938.1); contains InterPro domain Protein of unknown function, ATP binding; (InterPro:IPR004130)
Range:  from: 11572802    to: 11575157    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.