Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                            <---------ARR11(2)                                    --
                                            <---------ARR14(2)                          <---------AHL20(2)
                                            --------->ARR14(2)                      <---------RVE1(1)
                                           --------->KAN1<---------GATA12           <---------CCA1(1)
                                           --------->GLK1(1)                       <---------ARR11(3)
                             <---------DOF5.7(1)    --------->RVE1(2)              <---------RVE1(2)
-->ZmHOX2a(2)            <-------TEIL      <---------GLK1(1)                       --------->ARR11(3)
----ARR11(3)     --------->ZAT6          --------->YAB1  --------->GATA12    ------->TEIL        ---
--->GATA12     ----------->RAV1(1)      <---------YAB1------>ZmHOX2a(2)     <---------CCA1(2)   <---
ctatatgatcaacatgtccaacactagtttcattttttctactatgatatccgatgatccaatctgaactatacaaaatgtatctagatattttcttgaa  8360700
                                              <---------ANAC46                                 -----
                                             <---------AtMYB61                                <-----
                                         ------>ZmHOX2a(2)                                   <------
       --------->MYB52(1)                ====================HOX2a_HOX2a              <---------RVE1(2)
      <---------KAN1               <---------ANAC58                   --------->ARR11(3)   <--------
   --------->LBD16                 <---------ANAC58             --------->HSFB2a(2) <---------YAB1
------->WOX13(1)                   <---------ANAC46   <------ZmHOX2a(1)         <---------DOF5.7(1)
------>YAB5  <---------KAN1      ------>MYB83--------->ALFIN1   <---------HSFB2a(2) <---------YAB5 <
------YAB5--------->YAB5         ------>MYB46(1)     <----------ID1   <---------ARR11(3) <----------
tcaatccgaataacgaatagttgcaaaacataaacctagcgtgatcgtgtggtagaaggacgaaggtcgagaagttctcttactcttatgattttctctt  8360800
                               <---------AGP1--------->ZAT2                                       --
    ----------->HVH21          <---------GATA12                                                   <-
    --------->WRKY12           --------->ARR11(3)   <------NtERF2                                 --
---->ZAT14                     <---------ARR14(2)  --------->LBD16                       --------->LBD16
-----DOF2                      --------->ARR14(2) <---------ANAC46                       ------>NtERF2
---DOF5.7(1)         --------->MYB52(1) --------->SPL7(1)           <-------GAMYB        <---------ATERF1(1)
---GT1              --------->ARR11(1)<---------SPL7(1)      <---------ICU4             --------->RAP2.6(2)
---------YAB5   ---------->DOF2<---------ARR11(3)<---------LBD16<------ZmHOX2a(1) --------->DOF5.7(1)
-GT1--------->WRKY38(1)       <------ZmHOX2a(1)------->GAMYB<---------ATHB12    ---------->DOF2   --
tactcatttgaccgtaagagaaagaaacggctaggatctcgcgtacgcaactggcggagacaaatcaggaccgttgaaaataagaaagaagccgcgtcca  8360900
              <----------DOF2                                  <---------YAB1
             <---------DOF5.7(1)                               --------->ICU4
             <---------DAG2                               --------->ANAC46
          <---------ALFIN1                                --------->bZIP60(2)
       --------->PCF2                                ------>NtERF2
      <-----------HVH21                             --------->LBD16                               <-
 <----------DOF2                                    ----------->HVH21  --------->RVE1(2)      ------
------->GLK1(2)                           ------>ZmHOX2a(1)<-----------TGA1                   ------
--------ARR11(3)                 <---------ANAC58   <---------ETT(1)   <---------ARR11(3)    -------
------->ARR11(3)   <---------ZAT18     ------>NtERF2--------->ANAC46   --------->ARR11(3)  <--------
------->RVE1(2)   ---------->ID1 <---------ANAC58  --------->LBD16    <---------CCA1(2)  --------->DOF5.7(2)
aaatctttgtgtcccacctttgtccccttgcctctaacttgcctcctcatgctccccgacaacgtcataattcatatctctctctctctctcgttaaccc  8361000
                     --------->AHL12(3)                                                --------->RVE1(2)
                     ----------->TBP                                               --------->YAB1
                     --------->AHL20(2)                      --------->ANAC58      <-----------GT1
                     --------->AHL25(1)                      --------->ANAC58    --------->RVE1(2)
                     <---------AHL25(1)               ------->GAMYB         --------->RVE1(2)
   ---------->DOF2 ----------->TBP                   *TSS--------->ANAC46  --------->GLK1(1)
--------WOX13(2)------>ZmHOX2a(1)                   --------->ZAT14        <---------GLK1(1)
--->TOE2(3)    --------->TOE2(3)                  --------->ANAC46         <---------KAN1
--->TOE1(3)<----------DOF2                      --------->ANAC46       <---------TOE2(3)   ---------
-->ZAT6  <---------KAN1                    --------->YAB5--------->ANAC58 <---------ARR11(3)
-DOF5.7(2)<---------DOF5.7(1)              <---------ICU4--------->ANAC58 --------->ARR11(3)    ----
taatttcaaagcatctttccttatataaatctctctctctccctcaccattacacaacacacacaagcattttcaaggatatcaaatcacaatcccaaga  8361100
                                           <---------ARR11(3)          --------->ARR14(2)
                                           --------->ARR11(3)          --------->GLK1(2)         ---
    --------->YAB1                   <------ZmHOX2a(1) <---------DOF5.7(2)        <<<<<<<<<<<<<<<<<LFY
------>AGL15                       <---------TOE1(3) --------->DOF5.7(2)<---------KAN1           ---
----->DOF5.7(1)>>>>>>>>>TBF1       <---------TOE2(3)<-------GAMYB      <---------ARR14(2)   <-------
agagcaataacaagagaagaagaagtagttcaagaattaaggaagagagcttctccgttaaagtatagtgagagaatatggaagtcaccaatgggcttaa  8361200
                                                          <----------DOF2                    -------
                                                         <---------HSFB2a(1)    ---------->DOF2
                              --------->LBD16            --------->HSFC1(2)     --------->MYB46(3)
                             --------->ANAC46            --------->HSFB2a(1) --------->MYB46(3)
   <------ZmHOX2a(1)     --------->KAN1                  <---------HSFC1(2)  --------->REM1(1)  ----
------>TOE1(3)          <---------KAN1                 <<<<<<<ZML2<-----------HVH21     --------->ANAC58
------>TOE2(3)   <---------MYB52(1)                    <---------ARR11(3)  ----------->RAV1(1) -----
---DOF2       <-------TEIL  <---------LBD16     --------->MYB46(3)<-----------TGA1      --------->ANAC58
ccttaaggacacagagcttcgtttgggattacccggagcacaagaagaacaacaactagaactttcttgcgtcagaagcaacaacaagcgcaagaacaac  8361300
                      ------>ZmHOX2a(1)  --------->ARR11(3)
                   ------>ZmHOX2a(1)     <---------ARR11(3)
                   ===============================HOX2a_HOX2a                                      <
              <---------At4g35610        <---------ARR14(2)                                        <
          <---------GATA12               --------->ARR14(2)                                      ---
          <---------ARR14(2)             <---------RVE1(2)                                       <--
          <-----------ARR10              --------->GATA12                                        ---
          --------->ARR14(2)             <---------GATA12                                       <---
          --------->GLK1(2)              --------->AGP1                                         <---
         <---------GLK1(2)               <---------AGP1                                         ----
    ------->GAMYB <---------ALFIN1      <---------GLK1(1)                                     ------
 --------->MYB52(1)==============================HOX2a_HOX2a                             <---------ZAT14
 ----------->RAV1(1) <---------ALFIN1  ----------->ARR10                                 --------->ZAT14
-->MYB52(1)<---------KAN1=========================HOX2a_HOX2a                            <---------ZAT18
----->YAB5--------->ARR11(2)---------->DOF2------>ZmHOX2a(2)   --------->RVE1(2)       -------------
---->MYB46(3) --------->At4g35610  <---------WOX13(2)     --------->AHL20(2)      --------->WOX13(1)
gactcaacagaagaatctgctcctcctcctgcaaagtaagttgagatctgaaagttatagttttaatatccaaacttcttgatatcaatcggtgtactaa  8361400
---------YAB5                                               ------->GAMYB
---------YAB1                                            --------->MYB52(1)
----->HAHB4                                            ------>ZmHOX2a(2)
-------ICU4                                          --------->GATA12
------>YAB1                                          --------->AGP1
------ATHB51                         <---------AtLEC2<---------ARR11(3)                         ----
------ATHB12                        --------->MYB55(2)--------->CCA1(2)                     <-------
----->ICU4                          <---------MYB46(3)<------ZmHOX2a(2)                     <-------
--->YAB1                        --------->ATHB12     --------->ARR11(3)            <---------ANAC55(2)
-->AtSPL8                      <---------ATHB12      <---------GATA12      ----------->RAV1(1)------
taatgaatcttgatttgtaaacttcagaacacaaatcgttggatggcctccagtgagatctaaccgtaagaacaacaacaacaaaaacgtgagttatgtg  8361500
                     <---------ARR11(1)     <---------ARR11(3)
                     --------->ARR11(2)     --------->GATA12
              --------->GLK1(1)     <---------ARR11(3)
              <---------ZAT2        --------->ARR11(3)                 ---------->DOF2
              --------->At4g35610   <---------AGP1                   --------->HSFB2a(2)
------>DOF2   <---------At4g35610   --------->GATA12                 <---------HSFB2a(2)           -
--ANAC46  <---------DEAR3(1) --------->SPL7(1)                 <-----------ARR10                ----
--ANAC55(2)   --------->ZAT2<---------MYB52(1)                 <---------ARR11(3)               <---
----->HVH21   <---------GLK1(1)     <---------GATA12         --------->LBD16                    ----
aaagtgagtatggacggagctccatatctccgtaagatagatctcaagatgtacaaaaactatccagagcttctcaaagcactagagaacatgttcaagt  8361600
<- Previous    Next ->

AGI:  At4g14560.1   
Description:  IAA1 (INDOLE-3-ACETIC ACID INDUCIBLE); transcription factor. Identical to Auxin-responsive protein IAA1 (IAA1) [Arabidopsis Thaliana] (GB:P49677;GB:O23312); similar to IAA2 (indoleacetic acid-induced protein 2), transcription factor [Arabidopsis thaliana] (TAIR:AT3G23030.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71286.1); contains InterPro domain AUX/IAA protein; (InterPro:IPR003311); contains InterPro domain Aux/IAA-ARF-dimerisation; (InterPro:IPR011525)
Range:  from: 8361054    to: 8361982    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.