Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         <---------YAB1               <-----------RAV1(2)
                         --------->ICU4               --------->HSFB2a(2)
                       ----------->GT1                =========================RAV
                      --------->ALFIN1                <---------HSFB2a(2)
                    --------->ZAT2              <xxxxxxxxxxxxxxxxsmallRNA(s)
                    <---------ZAT2           --------->GLK1(2)
                   <---------TOE1(2)        --------->GATA12
                  <-----------RAV1(2)       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
              xxxxxxxxxxxxxxxx>smallRNA(s)  <---------GLK1(2)
          --------->WOX13(1)                <---------ARR11(2)          <------NtERF2
         <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->ARR14(2)         ------>NtERF2
------->DOF2 <---------ICU4                 <---------ARR14(2)       ---------->ID1            <----
---HSFC1(1)  --------->KAN1                <---------At4g35610     <-----------RAV1(1)    ----------
-->HSFB2a(2) --------->YAB1                --------->KAN1<---------GATA12           ----------->GT1
-->HSFC1(1) <---------YAB5--------->YAB5  ----------->ARR10 <---------ANAC46 <xxxxxxxxxxxxxxxxsmallRNA(s)
---HSFB2a(2)<---------ATHB12             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->YAB1<-------
aaaagccttcttgcaatcatcccaggtggtgattaagtcatggggcagattcttctcccagatgtgtgttttgtcgcccaaggagaatggaaacaacagg  4441200
                                                                          --------->ALFIN1  <xxxxxxx
                                                                        <---------ANAC46    <xxxxxxx
           <---------ZAT14                                        --------->ALFIN1         <xxxxxxxx
           --------->ZAT14                                       xxxxxxxxxxxxxxxxxxx>smallRNA(se3)
      <xxxxxxxxxxxxxxxxsmallRNA(i)  <------MYB46(1)          xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
   <---------ARR11(2)               <------MYB83             xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
   --------->ARR11(2)              <---------AtMYB61       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
   --------->ARR14(2)     <---------RVE1(2)                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)
   --------->GATA12    <---------MYB52(1)                <-------TEIL  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
   <---------ARR14(2) <-------GAMYB--------->MYB59  --------->YAB1<---------AtMYB61--------->ATHB12
--ZmHOX2a(1)   ----------->HVH21 <---------MYB52(1)xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)     <xxxxxxxx
->RAV1(1)<---------DOF5.7(1)   <---------MYB46(3) --------->RVE1(2)<---------MYB46(3)     <xxxxxxxxx
----RAV1(2)<---------REM1(2)  <---------TOE2(3)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)   xxxxxxxxxxx
agtttgaatccgtcttcactgacaccgttgattttggttaggtttggagagcctatcaaattcatcaaggtggtcgagtggatcctccattggcagacca  4441300
          --------->LBD16                                                                  ---------
         ----------->RAV1(2)                                                           --------->MYB52(1)
         <---------LBD16                                                              ----------->HVH21
        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                                       ------>ZmHOX2a(1)
 <---------KAN1 --------->YAB1                                                    <-----------------AGL1
xxxxxxxxxxxxxxxsmallRNA(si3)                                                      ----------------->AGL1
xsmallRNA(le3) <---------YAB5            --------->HSFB2a(2)                      ----------------->AG
xxxxxxxxxxxxxxxxsmallRNA(le3)            <---------HSFB2a(2)                   <----------DOF2     -
xxxxxxxxxxxxxxxxsmallRNA(se3)       xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)        <---------ANAC58    <-
xxxxxxxxxxxxxxxxsmallRNA(fl3)     <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)        <---------ANAC58  ----
xxxxxxxxxxxxxxxsmallRNA(se3)      <---------DOF5.7(1)                  <-------TEIL ================
xxxxxxxxxxxxxxxsmallRNA(si3)      --------->YAB1<---------MYB46(3)==================================
xxxxxxxxxxxxsmallRNA(fl3)      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->ALFIN1--------------->AGL15
xxxxx>smallRNA(s)     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)       <------ZmHOX2a(1)<---------------AGL15
tggaatttgttcccctgaatcatcgagatgagaccactcttaatctcgaagttgttgttttggataacaggaggtgcaattcctttcctctaacggtgat  4441400
      --------->ARR14(2)                                                        <---------TOE1(1)
      ------->TEIL                                                              <---------TOE2(1)
      <---------ARR14(2)                                                    <---------ANAC58
      --------->ARR11(2)                                                    <---------ANAC58
      <---------ARR11(2)                                                    <---------ANAC46
     <---------CCA1(2)                                                  <---------ANAC46
   <---------ANAC46                                                     <---------ANAC58
--------->ALFIN1                                                        <---------ANAC58
-->KAN1                                <---------MYB52(1)              <---------ZAT2
>At5g28300<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                       --------->MYB111(2)        <--
-------->LBD16                    --------->GLK1(2)    <------NtERF2  <---------MYB46(3)       <xxxx
--------ANAC46            <---------AtLEC2<---------RVE1(2)          <--------P<-------TEIL   xxxxxx
-->ZmHOX2a(2)        --------->YAB5   <-------GAMYB   ------>NtERF2<---------MYB46(3)  <---------WRKY18(1)
===HOX2a_HOX2a      <---------ATHB12 <-----------RAV1(1)          --------->ALFIN1    --------->WRKY12
===HOX2a_HOX2a  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<---------DEAR3(1)--------->ZAT2 --------->WRKY38(1)
cccgtggtgtatctccagcaccaatgtttgcagggccattctgttgattttgttcgtcggccatttcaagtggttgctggggtacaaggttgactgtgtt  4441500
                    --------->KAN1                    <---------YAB1
              <---------HSFB2a(2)                <------MYB83
        xxxxxxxxxxxxxxxx>smallRNA(i)             <------MYB46(1)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
 <----------DOF2  <---------ZAT2    <---------YAB1 --------->ARR14(2)              --------->At4g35610
xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)           --------->MYB59<-------GAMYB       *TSS            <
<---------DOF5.7(1) --------->CCA1(2)      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)   <---------At4g35610
---------GT1  --------->HSFB2a(2)   <---------YAB5 <---------ARR14(2)    <---------KAN1            -
xxxxxxxxxxxxsmallRNA(fl3)   <---------MYB46(3)  --------->MYB111(1)  ------>ZmHOX2a(2)         <----
xxxxxxxxxxxxxxxxx>smallRNA(fl3)     <---------TOE2(3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)     ------
tctcctttctctgagttcgcgagctatgcggtcgatgttatcgttgataagtaggttctggttgcctgttgatcgagtttgcatacagcagaggtatacc  4441600
                                                                   --------->ANAC58         <-------
                                                                   --------->ANAC58         --------
                                                              <---------GATA12 --------->GATA12
         <----------ID1                                       --------->GATA12 <---------GATA12
<------ZmHOX2a(2)                                       <---------ARR11(3)    <---------GLK1(1)
---------GATA12             <---------MYB52(1)<---------WOX13(2)------>ZmHOX2a(2)      ----------->GT1
-------->GATA12        --------->ANAC46       <------------CBF<---------ARR11(3) --------->TOE2(3)
-----LBD16    --------->ANAC58           ----------->GT1--------->ARR11(3)    --------->GLK1(1)
----->RAV1(2) --------->ANAC58       ---------->DOF2---------->DOF2--------->ANAC46  <xxxxxxxxxxxxxx
tggatcaagaagacaacaagaaaaacacacagttagtacttgaagcgaaaattgaaaaagaacttgatctaagcaagtctgaaatctcaaatgtaacaaa  4441700
                                                 <---------YAB1 <---------ICU4
                                               --------->YAB1   --------->YAB1
                 --------->DEAR3(1)           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                --------->RAP2.3(1)           <---------ATHB12------>MYB46(1)
               ------->GAMYB                  <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
               <---------RAP2.3(1)           --------->WOX13(2)<---------YAB5
               <---------ATERF1(1)           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
      --------->WOX13(2)                     <---------WOX13(2)<---------ATHB12
      <---------WOX13(2)                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
  --------->ANAC58          <---------YAB1  --------->WOX13(1)------>MYB83
  --------->ANAC58 <------NtERF2           <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
  --------->ANAC46------>NtERF2            <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)         <----------DOF2
--MYB52(2)    <---------DEAR3(1)          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)      --------->ARR11(3)
->MYB46(3)  --------->MYB52(1)  <-------TEIL<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)     <---------ARR11(3)
xxxxxxxxxsmallRNA(se3)     <---------TOE2(3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  --------->MYB59
caaacacccaattagcaacggcgccaaattgatgatacatttttagtcaattatcctaaaacaccaatcatggcattgtagtattttaggtctttaatcc  4441800
                --------->ANAC58                                                     ------>ZmHOX2a(1)
                --------->ANAC58                                                     <xxxxxxxxxxxxxx
               --------->WOX13(1)                                           --------->HSFC1(1)
            --------->ANAC58 --------->YAB1        --------->ANAC58         --------->HSFB2a(2)    -
            --------->ANAC58<---------ATHB12  --------->ANAC58              >>>>>>>ZML2            -
          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)    --------->ANAC58         <---------HSFB2a(2)    -
        <---------YAB1  <-------TEIL          --------->ANAC58              <---------HSFC1(1) -----
      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->WRKY18(1)         --------->ALFIN1<xxxxxxxxxxxx
aaatgagtgtgatgctagcaatcaagatgcaatcagagttcaaagagtcaagcccagcaataacaggtttaggggtgttctagaagtcctaagtgaacat  4441900
xxsmallRNA(i) --------->ANAC58                                                      <---------WRKY18(1)
-------->ANAC58                                                            --------->WOX13(2)
-------->ANAC58        --------->At5g28300                                 <---------WOX13(2)
-------->ANAC46       ----------->GT1  <----------DOF2                    --------->WOX13(1)
---->AtLEC2   --------->ANAC58  <<<<<<<<<TAC1                    --------->YAB1<---------YAB1
xxxxsmallRNA(i) --------->YAB1--------->KAN1 --------->KAN1     <---------YAB1 <---------TOE2(3)  --
gcaggaaacagaaattcaagcaaaacagtaaaaacactcgagctttcgatgttctcacaatagacttatgatgttttcaattaagcttgaccaatagatt  4442000
                        <---------AHL25(1)                                                     <----
                        --------->AHL12(3)                                                     -----
                        <---------AHL20(3)                                                     <----
                        <---------AHL12(2)                                            --------->YAB5
                        <---------AHL12(3)                                            --------->ATHB12
                        --------->AHL20(3)                                           <---------YAB1
                       --------->AHL20(2)                            --------->ARR14(2)        -----
                       --------->YAB1                                <---------ARR14(2)        <----
                 --------->ANAC58          <---------At4g35610      --------->KAN1 <---------At4g35610
                 --------->ANAC58          --------->At4g35610     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
               ---------->DOF2        --------->WOX13(1)        <---------ANAC46 <--------P    <----
          ---------->DOF2         ----------->GT1 ---------->DOF2<---------TOE2(3)<-------TEIL -----
------->AHL20(2)--------->DAG2   <---------ARR11(3) --------->DOF5.7(1)     <---------O2<---------YAB1
ataaaataagaaataaagaaaagcaataaaaatcaagatgtaaatcagatgagaaaagagtcaagtttagggtattctcacgaggtagatgattagtaga  4442100
<- Previous    Next ->

AGI:  At4g07660.1   
Description:  transposable element gene. gypsy-like retrotransposon family (Athila), has a 6.9e-240 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana)
Range:  from: 4436758    to: 4441584    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.