Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                 --------->DOF5.7(1)
                                                                 --------->DAG2
                                                                ---------->DOF2
                                                         ----------->HVH21
                                                       <---------At4g35610
                                                       ----------->RAV1(2)
          ----------->GT1                              <xxxxxxxxxxxxxxxxsmallRNA(le3)
         --------->DAG2   <---------ANAC58             --------->At4g35610
         --------->DOF5.7(1)                         --------->ARR11(2)
        --------->DOF5.7(1)                          --------->ARR14(2)      ---------->DOF2
       ---------->DOF2  --------->ARR11(3)           <---------ARR14(2)     <------ZmHOX2a(1)
 <---------AtLEC2       <---------ARR11(3)           <---------ARR11(2) --------->DOF5.7(1) --------
------>YAB5  <-------TEIL <---------ANAC58  ---------->DOF2    ---------->DOF2 --------->DOF5.7(1)
 
tgatgcatggaaaaggttcataccgaagagcttgaggtctccatcttcaaaggctggaacctgaccaaaaggctgaagaggaaagaagttcaaacacaaa  1111300
                  <-------TEIL                                                    --------->LBD16
                 --------->CCA1(2)                                               <---------LBD16
                --------->ARR11(2)                                               <---------ANAC58
                --------->ARR14(2)                                          <---------ANAC58
                <---------ARR11(2)                                  --------->CCA1(2)       --------
                <---------ARR14(2)                                 <---------RVE1(2)      <---------ARR11(2)
          --------->ANAC46                                         --------->ARR11(3)     --------->ARR11(2)
          --------->ANAC58                                  --------->CCA1(2)    <---------ANAC46
       <-------TEIL                                        <---------RVE1(2)<---------ANAC58<xxxxxxx
    <---------At4g35610                                    --------->ARR11(3)    <---------ANAC58  -
    --------->At4g35610         <------MYB46(1)            <---------ARR11(3)   <---------LBD16  <--
   <---------RVE1(2)            <------MYB83      ----------->RAV1(1)      <---------TOE2(3)--------
->ANAC46  --------->ANAC58    <---------MYB52(1) --------->MYB46(3)<---------ARR11(3)    <------ZmHOX2a(1)
 
acatttgagatgcaggccagatacatgaaaacagttggtctcttgtcttacaacaacacatagatatatagatatacttacgttgcgggagaggaaaggc  1111400
               <---------DOF5.7(1)
      <---------At4g35610
      <---------ZAT18                                                                          <----
 --------------------->WRI1                                                                    -----
->DAG2--------->At4g35610                                           <----------CDC5            <----
xxxxxxxxxxxsmallRNA(le3)                                          <---------DEAR3(1)  <------NtERF2<
----->ZmHOX2a(1)                                               <---------DEAR3(1)------>ZmHOX2a(1) <
-------DOF5.7(1)<----------DOF2         ---------->DOF2       <---------ANAC46 ----------->RAV1(2) <
->DOF5.7(1) --------->DEAR3(1)      --------->At4g35610  <---------ANAC46<------ZmHOX2a(1)     -----
 
tccttcttgtgctcaccgtctttgagttcgacatgaacgagctcaaagtcgaggtttttctcgtggagggcgatgaggactctcctggtggcaatggaag  1111500
  <---------SPL7(1)
-----At4g35610               <---------RVE1(2)                               --------->DOF5.7(1)
---->At4g35610              --------->ATHB12                                --------->DOF5.7(1)
-----ZAT2             ------>MYB46(1)                                      ---------->DOF2
---------ANAC58       ------>MYB83                                    ----------->GT1              <
---------ANAC58      --------->ANAC46                               --------->DOF5.7(1)      <------
---------ANAC46     <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)        --------->DOF5.7(1)        -------
---->ZAT2        <-----------GT1                  <----------DOF2 ---------->DOF2<------ZmHOX2a(1) <
 
ctgggtgtccgaaaactttgatacctgccattgatttgggttactaagaaactctttgaagactgagaaaaaagagagaaaagaggaagaaatgtgatgt  1111600
                                               <---------AHL20(2)                    --------->AHL25(2)
                                          --------->ARR11(3)                         --------->AHL20(3)
                                        <---------TOE2(3)                            <---------AHL25(2)
                                     --------->ICU4                          --------->ICU4
                                --------->ANAC46                            <---------TOE2(3)      -
---------TOE2(3)                --------->ANAC58                      <---------YAB1 <---------AHL20(3)
---YAB1                         --------->ANAC58           <---------KAN1<---------YAB1 --------->RVE1(2)
-->ICU4  --------->ALFIN1       --------->ANAC55(1)        *TSS   <----------DOF2 --------->AHL12(2)
---------RVE1(2)         --------->ANAC46 <---------ARR11(3)   <-----------GT1--------->YAB5--------
 
ttgatgttgaaggtgaaggtgatgaaataagacacaagtaatgaaggtatttatacagaagcatttctactttctcattaatgtttaatattatctaaca  1111700
                                                                                               <----
                                                                                               <----
                                                                    <---------At4g35610        <----
                                                                    --------->At4g35610       ------
                                                          --------->ARR11(3)                 -------
  --------->YAB1                                          <---------ARR11(3)               ---------
  <---------ICU4               <------------CBF           --------->ARR14(2)            --------->YAB5
  -------->HAHB4               <---------ICU4             <---------ARR14(2)            --------->TOE2(3)
 --------->ICU4           ------------>CBF               <------ZmHOX2a(1)            <---------TOE1(3)
<---------AHL20(3)        --------->MYB46(3)       --------->HSFB2a(2)                <---------TOE2(3)
--------->AHL20(3)       --------->ANAC58          <---------HSFB2a(2)               <-----------GT1
-------->YAB1            --------->ANAC58         <---------LBD16---------->DOF2     <---------DOF5.7(2)
->MYB52(1) <---------REM1(2)   --------->YAB1 <<<<<<<<<TBF1<---------KAN1       ----------->GT1-----
 
gataataatgcctctacaaggccatcgcaaccaatattgactagtcttcttcttctgggaggatttttcaaagctgaattggactgtttaacgtttaaat  1111800
  <----------DOF2
 <---------ANAC58                --------->DAG2                        <---------ANAC58
 <---------ANAC58               ---------->DOF2                        <---------ANAC58
-----AHL12(1)                 <---------WOX13(2)            --------->YAB5
-----AHL25(1)                 --------->WOX13(2)            --------->YAB1
-----AHL20(2)               <---------AHL20(2)             <------ZmHOX2a(2)
--->AHL25(3)         <---------YAB5                       <---------ARR11(3)
-->AHL12(2)     --------->ANAC55(2)                     --------->DOF5.7(1)              --------->YAB5
>AHL20(2)  <---------MYB46(3)--------->YAB1           ---------->DOF2  <---------ANAC46 <---------ATHB12
---->AHL12(1)   <---------ANAC55(2)           ------->TEIL--------->ARR11(3)     <----------ID1
 
atttgcttttacattggttatgtaatggtttttaataaagtattcaatgtatcagagaaaagatcataactagtgcgtagtaataggccaaatgactcaa  1111900
                                                                <---------LBD16
                                                                --------->HSFB2a(2)
              --------->REM1(1)                                <---------ANAC46
             <-------TEIL                              <---------MYB52(1)
      ------>MYB46(1)                                <------MYB46(1)
      ------>MYB83                                   <------MYB83--------->LBD16     <---------ARR11(3)
      -------->P                <---------DOF5.7(1) --------->MYB59 <---------ARR14(2)
    <---------MYB111(2)        <---------DOF5.7(1)--------->ARR11(2)--------->ARR14(2)
    <---------MYB46(2)   <----------DOF2          <---------ARR11(2)<---------RVE1(2)--------->ARR14(2)
    <---------MYB111(1) <---------ANAC58    --------->ATHB12   <---------LBD16       --------->RVE1(2)
 <---------ALFIN1       <---------ANAC58   <---------YAB1     <---------LBD16       <---------CCA1(2)
 
acttccacctactagcttcatctagtagctttcccccttcttggttatgactggttcggttttgtttcggggattttgtgatgctctatatctgtatgcc  1112000
                                                             <----------DOF2
                                                            ------>ZmHOX2a(2)
                                                           <---------RVE1(1)
                                                           <------ZmHOX2a(2)
                                                          --------->ARR11(3)
                                                          --------->ARR14(2)
                                                          <---------AGP1
                                                          --------->AGP1
                                                          <---------ARR11(3)
                                                          <---------ARR14(2)
                                     <----------ID1       --------->GATA12
             <---------GLK1(1) <-------TEIL<---------TOE2(3)<---------DOF5.7(1)
         --------->DOF5.7(1)  --------->GLK1(2)           <---------GATA12               ---------->DOF2
       --------->DOF5.7(1)   --------->GATA12             <---------RVE1(2)          <-----------GT1
       ---------->DOF2       <---------GATA12            <---------CCA1(2)        --------->AHL12(2)
  ----------->GT1          <---------RVE1(2)            ----------->ARR10         <---------AHL12(2)
 
ttctcaagttaaaagggtttctcttaatgtgagattcaatagaacaaaggtttactgatcagatctttttgaattagtttcagataaataaccaaagaag  1112100
               <---------ARR11(2)--------->KAN1
          <---------ANAC58  <---------ANAC46                --------->ARR11(3)
          <---------ANAC58 <---------AtMYB61         --------->TOE2(3)
          <---------ANAC46 --------->ALFIN1        ------->TEIL                                  ---
     ----------->GT1     <---------ANAC46          -------->P                                   <---
    <---------AtMYB61 <---------AtMYB61        --------->RVE1(2)                         -----------
 <---------RVE1(2) <----------DOF2       ----------->GT1    <---------RVE1(2)--------->ICU4   ------
 
ttttggtatggtttcttggttccttttggtgtggtggaattcgatggaaaaatcaaccttgttgatattgatgcatagtaagtatgaacaaaatgtataa  1112200
<- Previous    Next ->

AGI:  At4g02520.1   
Description:  ATGSTF2 (Arabidopsis thaliana Glutathione S-transferase (class phi) 2); glutathione transferase. Identical to Glutathione S-transferase PM24 (PM24.1) [Arabidopsis Thaliana] (GB:P46422); similar to ATGSTF3 (GLUTATHIONE S-TRANSFERASE 16), glutathione transferase [Arabidopsis thaliana] (TAIR:AT2G02930.1); similar to glutathione S-transferase 4 [Brassica juncea] (GB:AAP58394.1); contains InterPro domain Thioredoxin-like fold (InterPro:IPR012336); contains InterPro domain Glutathione S-transferase, C-terminal-like (InterPro:IPR010987); contains InterPro domain Thioredoxin fold (InterPro:IPR012335); contains InterPro domain Glutathione S-transfera
Range:  from: 1110452    to: 1111660    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g02530.1   
Description:  chloroplast thylakoid lumen protein. Identical to Thylakoid lumenal 16.5 kDa protein, chloroplast precursor [Arabidopsis Thaliana] (GB:O22773;GB:Q8L985;GB:Q94BU6;GB:Q9M110); similar to unnamed protein product [Vitis vinifera] (GB:CAO65696.1)
Range:  from: 1112141    to: 1114029    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.