Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
      --------->ARR11(2)                  <---------RVE1(1)              --------->AHL20(1)
      <---------ARR11(2)                 <---------RVE1(2)               --------->AHL12(1)
      <---------ARR14(2)                 <---------ARR11(3)              --------->AHL25(1)
      --------->ARR14(2)             <---------ANAC46                    --------->AHL25(3)
     <---------GLK1(1)               ----------->GT1                     <---------AHL25(2)
   <------MYB83     <---------CCA1(2)<---------ANAC58                    --------->AHL25(2) <-------
   <------MYB46(1)<---------DOF5.7(1)<---------ANAC58               ------------>CBF --------->AHL12(1)
-AHL20(2)       ------->TEIL <----------DOF2                      <---------PCF5   <---------RVE1(2)
gttggaaggtatctgtatgcatcttatcttcgttttagggtcgtgatattttctcaagtttttcttaggggaccaatttatttttagatttatttgattc  23146600
                                  <---------ANAC55(2)                        <---------ATHB12  <----
                                  --------->ANAC55(2)                <------ZmHOX2a(2)        ------
                                  <---------ANAC55(1) --------->MYB52(1)   --------->WOX13(1)-------
                                  <---------ANAC58  <---------MYB59 <---------ARR11(3)       -------
                          <----------DOF2    <---------RVE1(2)      --------->RVE1(2)        <------
                 <---------DOF5.7(2)      <---------TOE2(3)   --------->RVE1(2)             <-------
              --------->WOX13(2)  <---------ANAC58 --------->ANAC55(2)   --------->WRKY18(1)<-------
 <-----------GT1<---------ZAT18--------->ARR11(2)  <---------ANAC55(2) --------->WOX13(1) --------->WOX13(1)
--RVE1(2)  <---------MYB52(1)  <---------ARR11(2)<-----------GT1    --------->ARR11(3) --------->TOE2(3)
tatcttacatttctcttagttcacgttgtctttgtatacgtgtttatggatattacataactgaaaatcaagatcagtcaatcagtgtaacatcaatcat  23146700
-----YAB1                                       --------->GATA12                           ---------
--->TOE2(3)    ------->TEIL            <------ZmHOX2a(1)                             --------->GATA12
-->YAB1     <---------KAN1            ----------->GT1--------->LBD16    <---------YAB5    <---------YAB1
-->YAB5     ----------->GT1      --------->CCA1(2) ----------------->AGL3            --------->RVE1(2)
---ICU4<---------ANAC46        --------->CCA1(2)<---------GLK1(2)  --------->AHL12(2)<---------ARR11(3)
--ATHB12--------->LBD16        <---------KAN1  --------->At4g35610 --------->AHL12(3)--------->ARR11(3)
--YAB5<---------LBD16    --------->MYB52(1)--------->RVE1(2)  <-------TEIL      --------->TOE2(3)
caataaccctgcgggatgtatataaaactaagggatatatgaggaaaatcagattccagattaagttcataaatattgattcacctaaaatctataataa  23146800
                    --------->YAB5 --------->YAB5        --------->RVE1(2)
                    <---------AHL12(1)                  --------->CCA1(1)
                    <---------AHL25(3)                  --------->RVE1(1)
                   <---------AHL20(2)                 --------->AHL20(3)
                   <---------AHL12(1)                 --------->AHL12(3)
                   --------->AHL12(1)                 <---------AHL20(3)               ---------->DOF2
                   --------->AHL25(3)      --------->RVE1(2)                         ----------->HVH21
                   <---------ATHB51<---------ICU4   --------->AHL20(2)    --------->DOF5.7(1)
                   --------->AHL20(2)      <-----------GT1      <------------CBF   ----------->RAV1(2)
                   --------->AHL25(1)   <---------AHL12(2)     <---------KAN1<-----------HVH21
                   --------->ICU4--------->ARR11(3) --------->AHL20(3)  --------->CCA1(2)
>YAB1              <---------AHL25(1)<---------YAB1 <---------AHL20(3) <---------RVE1(2)     -------
catagtagttcagaagcatgaaataattctataaaaaatcatgaattatctacataaaaatatcgcatattgtagataagagtcacccctgaaagaaaaa  23146900
              <------MYB83                                  <---------ICU4
       <---------------AGL15                               *TSS                         <---------ARR11(3)
       --------------->AGL15               --------->ARR11(3)                           --------->ARR11(3)
      <-----------------AGL3               <---------ARR11(3)                           --------->RVE1(2)
      <-----------------AG                <---------CCA1(2)--------->ICU4              --------->CCA1(1)
      <-----------------AGL2    <-----------RAV1(1)   ----------->GT1   <------ZmHOX2a(1) >>>>>>>>>RAP2.2
      <-----------------AGL1  ------>ZmHOX2a(1)      <---------TOE2(3)<---------TOE2(3)<---------KAN1
-->DOF5.7(1)  <------MYB46(1)--------->TOE2(2)  --------->RVE1(2)   ---------->DOF2    --------->RVE1(1)
cgatagttttctgtatttggttatcaatcaatcctatgtgggtttatatcttatctaatgtaaaaattacacaaaggatagtgtctgcaaatatctaaat  23147000
                     --------->GLK1(1)                            <---------ATHB12
           <---------------AGL15                                  <<<<<<<<<ARR2
           --------------->AGL15                                  <<<<<<<<<ARR1
          ----------------->AG                          --------->YAB1
          ----------------->AGL1                        ----------->GT1
          ----------------->AGL2                   --------->AHL20(2) <---------GLK1(2)            -
          =======================================================MADS_MADS                      ----
          ----------------->AGL3         --------->STY1(2)   --------->ZAT6             <---------ARR11(3)
   <---------ANAC55(2)        <------MYB83       ===================================================
   --------->ANAC55(2)        <------MYB46(1)    <---------------AGL15<---------ICU4    --------->ARR11(3)
   --------->ANAC55(1)      --------->ALFIN1 <---------WOX13(2)   <---------YAB5   <-----------HVH21
gaaaacacttaattccaaaatgagaaatcaagtgggttttgcctagctaattgtataaatagtaacacaatcataatctcttcttccatcaggtcttctt  23147100
  <---------AHL12(1)         ---------->DOF2               ---------->DOF2
  <---------AHL20(1)     --------->ANAC58               ----------->GT1
  --------->AHL12(1)     --------->ANAC58              --------->DAG2                  --------->DOF5.7(1)
  --------->AHL20(1)   ---------->DOF2                 --------->DOF5.7(1)           ---------->DOF2
-------->AHL20(2)<---------YAB5                   --------->HSFB2a(2)       ---------->DOF2
----->YAB1    --------------->AGL15               <---------HSFB2a(2)   <---------ARR11(2)
==============================MADS_MADS    --------->AHL12(2)          <------ZmHOX2a(1) <---------ARR11(3)
cataatatatttcttctctaataattgaaagcaaaagaaaacagtttttttttttagaaaggtaaagaaatggaggaaacaaaggagagaaagatagtag  23147200
                                                                               --------->ANAC46   --
           <---------------------WRI1                                    <--------ATHB1           --
        ---------->DOF2                                                  --------->YAB1         ----
      --------->ANAC58                                            <---------ARR11(2)          <-----
      --------->ANAC46                                            --------->ARR11(2)  ------>ZmHOX2a(1)
      --------->ANAC58                              <---------DOF5.7(1) <---------ATHB51     -------
 --------->At4g35610             <-----------HVH21--------->GLK1(2)     <---------ATHB12 ------>ZmHOX2a(1)
tagcagtagacgaaagcgaagagagcatggaagctctgtcatggagtcttgacaatctttttccatatggttccaataatacactcatcctcctctacgt  23147300
               --------->KAN1                                               <---------YAB5
              <---------ARR11(2)                                <-----------ARR10
      <---------DOF5.7(1)             <--------P                --------->ARR11(3)
     <---------DOF5.7(1)           <---------TOE2(2)            --------->RVE1(2)          <--------
    <---------ALFIN1               <---------TOE1(2)            <---------ARR11(1)     <---------ZAT18
------->ANAC58--------->ARR11(2)  <-----------RAV1(2)           <---------ARR11(3)     --------->ZAT14
------->ANAC58--------->ZAT14 ------>NtERF2  ------>ZmHOX2a(1) <---------CCA1(2) --------->GLK1(2)
------>DOF2   --------->ARR14(2)  <------NtERF2              --------->YAB1<---------WOX13(2)
------HVH21  <---------MYB52(1)  --------->LBD16            <-------TEIL   --------->WOX13(2)
-->ANAC46   <---------DOF5.7(1)  ------>NtERF2     <----------DOF2 <----------DOF2     <---------ZAT14
caagccccctcttcccgtttactcttccctcgatgccgcaggttagtcctcgttctttcacgattcatatctttccctaattataatctgttcactttag  23147400
                  <---------GLK1(1)             <-------GAMYB
                  --------->GLK1(1)             <-----------HVH21
            <------MYB83                     <---------LBD16                           <---------YAB5
            <------MYB46(1)                --------->ARR14(2)                        <---------ARR14(2)
           --------->MYB59                 <---------ARR14(2)                    <-------PIF5
           <---------MYB46(3)             <---------GLK1(1)                      ------->PIF5
  <---------RVE1(2)                       --------->GLK1(1)                  <---------ZAT2
  --------->ARR11(3)                     ----------->HVH21           --------->YAB5  <---------ARR11(2)
  <---------GLK1(2)    --------->LBD16  <------ZmHOX2a(1)           <---------YAB1   --------->ARR11(2)
  <---------ARR11(3)  <---------LBD16<-----------RAV1(2)<----------DOF2--------->ARR11(2) <---------
--DOF2     <---------AtMYB61      ----------->HVH21   --------->At4g35610    --------->ZAT2---------
ttatagatttttgtttggtcgatttccagggtttatagtgacaggagacccggttgcagctttgaagaagtatgaatacgagctcgtggaatcggtcatg  23147500
<- Previous    Next ->

AGI:  At3g62550.1   
Description:  universal stress protein (USP) family protein. similar to ethylene-responsive protein, putative [Arabidopsis thaliana] (TAIR:AT1G09740.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40101.1); contains InterPro domain UspA; (InterPro:IPR006016); contains InterPro domain Universal stress protein (Usp) (InterPro:IPR006015); contains InterPro domain Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729)
Range:  from: 23146960    to: 23148149    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.