Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       <---------AHL20(2)                                            <---------AHL20(2)
       --------->AHL20(1)                                            <---------AHL20(1)            -
       --------->AHL20(2)                                   ----------->GT1  --------->ARR14(2)  <--
       <---------AHL20(1)                                   --------->ANAC55(2)   <---------At4g35610
-->LBD16               <-----------GT1      <---------YAB1  <---------ANAC55(2)   ----------->RAV1(2)
->ANAC58          ----------->GT1  <---------MYB46(3)  <---------ICU4--------->AHL20(2)   <---------AHL20(2)
->ANAC58        ---------->DOF2   <---------AtMYB61  <---------TOE2(3)<---------AHL20(2) --------->AHL20(2)
->ANAC46--------->ATHB12       <---------AtMYB61<---------ZAT6 <-----------GT1    --------->At4g35610
 
actaggccattttattggtaaaagtaaaaccattttggtggtcgtctatgagtgttaagaattatgtaacaatttttttggattcacctgaaataaatct  21360100
                                                           --------->AHL20(2)
                                                           <---------AHL20(1)
                                                           <---------AHL20(2)
                                                           --------->AHL20(1)
                                                        --------->YAB1
                                                       <---------YAB1
                                                      <---------AHL20(1)                     -------
                                                      <---------AHL20(2)                    <-------MYC2
                                                      --------->AHL20(2)              <-----------GT1
                                                     --------->YAB1       --------->STY1(2) <-------MYC3
                                                    <---------YAB1        <---------At4g35610-------
                                                   --------->TOE2(3)      --------->At4g35610-------
                                                  --------->YAB1          --------->ZAT2    ------->MYC3
                                                  <---------ICU4  ---------->DOF2 <---------DAG2----
-------->ATHB12                             --------->AtLEC2--------->ATHB12      <----------DOF2
-------MYB52(1)                     --------->At4g35610--------->ICU4     <---------ZAT2    ------->MYC2
 
gttgatttgaaatatttggacgttacatttccatatataagcttaccatacaaacattataattaattggaaagtccagctagcactttttaccacatgc  21360200
                    --------->AHL20(2)
                    <---------AHL20(2)                   <------ZmHOX2a(2)
              --------->TOE2(3)                <---------ZAT6     ----------->RAV1(1)           <---
     <---------AHL20(2)              --------->ARR11(3)  <---------ATHB12                       <---
-->ANAC58    >>>>>>>>>MYB98       --------->YAB1  <---------ZAT14--------->ANAC46              -----
-->AtLEC2 <---------MYB59  =====================================HOX2a_HOX2a          <---------ANAC58
-->ANAC58--------->YAB1    <------ZmHOX2a(1)   <---------ANAC46  <---------ETT(1)    <---------ANAC58
------>DOF2------>ZmHOX2a(1)      <-----------GT1 <---------ARR14(2)              <-----------GT1<--
 
aaagggaattaatcctaacttaaaaaattaggagtaatcacatcttggtagtgtataccgatcaatttccgacagacgttttttttttccttgcccattg  21360300
                                  ------->GAMYB
                                 <---------ATHB12
                                 --------->MYB46(3)  <---------ARR11(3)
------ANAC58                    ------>MYB46(1)      --------->ARR11(3)
------ANAC58                    -------->P        <------ZmHOX2a(1)                        ---------
---->ATHB12               --------->WOX13(1)   --------->CCA1(2)                   ----------->GT1
-------WOX13(1) ---------->DOF2 ------>MYB83 --------->CCA1(2)    <---------YAB1  ----------->GT1
 
attgcatagttcaaaacttcaaagttggccaatccaaccaagtcgaagagataggagatgttttgaagtatgaaaacaaatagaggggctaaaatcaaaa  21360400
                                                                      --------->AHL20(2)
                                                             <---------ATHB12
                                                         ------------>CBF
                    --------->ALFIN1             --------->LBD16      --------->YAB1
                  <---------ANAC58              <---------ANAC46 <---------ATHB12
             <---------At4g35610               <---------LBD16   ------------>CBF
 --------->ANAC58 <---------ANAC55(1)       --------->At4g35610--------->WOX13(1)
 ----------->GT1  <---------ANAC58      <---------ARR11(3) --------->WOX13(1)      *TSS
 --------->ANAC58 <---------ANAC46 ------>ZmHOX2a(1)  <---------AHL20(2)        <---------ZAT6
>YAB1        --------->At4g35610  --------------------->WRI1 ------------>CBF --------->LBD16
 
taacaagaaaaaacgcttctgccgtgttcgaatgtgtcctcgtgatcatctccgtatataatcaatcaatcaataaaaatccagagttacaaacactctt  21360500
                                                             <------MYB46(1)
                                                             ----------->GT1  <----------DOF2
                         <---------AHL20(2)                  <------MYB83<-----------GT1
                      ----------->GT1               <-----------GT1 <---------AHL20(2)
             <---------AHL20(2)            ---------->ID1   <------MYB46(1)  <---------DAG2
             ---------->DOF2              <-----------GT1   <------MYB83<-----------GT1
            --------->AHL20(2) <-----------GT1 <----------DOF2     <---------AHL20(2)       <-------
     <-----------GT1---------->DOF2   <---------AHL20(2)  <--------P--------->AHL20(2)      --------
 
ctcaaaattttcccattaaatcgcaaagttaattttgcgattttttttctctttttttctggttgggttatttattttccccttttaaaaaacttctgca  21360600
                                                  --------->LBD16
                                                 <---------LBD16
                                                <---------LBD16
                                                <---------ANAC46
                                            --------->ARR11(3)
                                           --------->GLK1(1)
                                           <---------GLK1(1)                --------------->AtSPL8
                                       <---------HSFC1(1)                  --------------------->WRI1
                    <---------AHL20(1) --------->HSFB2a(2)       <------MYB83
                    <---------AHL20(2) --------->HSFC1(1)        <---------ANAC46
                    --------->AHL20(1) <---------HSFB2a(2)  <---------MYB46(3)
       <---------GLK1(1)              <---------LBD16       <-----------RAV1(1)<-----------GT1
--HSFB2a(2)   ----------->GT1--------->ATHB12  <---------LBD16   <------MYB46(1)         ------>ZmHOX2a(1)
->HSFB2a(2)   <---------ANAC46   <---------MYB46(3)     --------->ATHB12   <----------DOF2         <
 
acttgtcttgaaatctggggtaaaatatttcttcattggtttctggaaatctcggggaacgatttgttgggttttcttctttgtactctctcctcacatt  21360700
                                      <---------At4g35610
                                      --------->ZAT2
                                    <-----------RAV1(2)
                                   <---------At4g35610
                                --------->At4g35610
                              <---------WOX13(1)
      <------MYB83          --------->ATHB12
      <---------MYB46(3)    <---------MYB46(3)
      <------MYB46(1)      <---------YAB1                                             <-----------HVH21
     <---------AtMYB61   <------MYB46(1)           <----------DOF2       --------->ARR11(3)        <
  <---------MYB46(3)     <------MYB83 --------->At4g35610                <---------ARR14(2)        <
  <-----------RAV1(1) <------ZmHOX2a(1)  <-----------HVH21               --------->ARR14(2)    <----
----------DOF2      <---------TOE2(3) <---------ZAT2<----------DOF2     <---------CCA1(2)--------->WOX13(1)
 
agcttttgttggtgggattttttgaggatggtgattgctgcagctgtcatcgtgcctttgggccttctcttcttcatatctggtctcgctgtcaatctct  21360800
                                               <---------MYB46(3)
                                              <---------MYB52(1)
                                 <----------DOF2
                               <---------------AGL15                        <----------DOF2
     <------MYB83              --------------->AGL15                 ------>ZmHOX2a(1)
     <------MYB46(1)          <-----------------AGL3               ------>ZmHOX2a(2)
    --------->MYB59         <-----------GT1  <-------GAMYB        <------ZmHOX2a(2)
    <---------AtMYB61<---------ANAC46       <---------ANAC58     <---------ARR14(2)            <----
---------TOE2(3)   <---------ARR14(2)       <---------ANAC58     <---------ARR11(3)       <---------At5g28300
---------TOE1(3)   --------->ARR14(2)    --------->GLK1(2)       --------->ARR14(2)      <----------
------DOF2 <---------YAB1<---------ZAT6 <---------GLK1(2)        --------->ARR11(3) <---------YAB1
 
ttcaggtttggtttctgattcgtttctggtgttactctttttagattccgttgttgttctacattgtagatcctttcttcttttgttttgattcactgct  21360900
                                        <---------DEAR3(1)
                <---------GLK1(2)       --------->ETT(1)
              --------->LBD16           <---------DREB2C(2)
             <---------HSFB2a(2)        <---------At1g77200
   <---------GLK1(1)           <---------ANAC58
   --------->GLK1(1)           <---------ANAC58                                                    -
<---------TOE1(3)     <---------YAB1    <---------DEAR4(1)                                       <--
<---------TOE2(3)   <----------DOF2    <---------ORA47(1)        <---------ZAT18                 <--
------DOF2   --------->HSFB2a(2)     <-----------RAV1(1)    <---------YAB1            --------->ANAC58
-GT1        <---------LBD16 <----------DOF2 <---------MYB46(3)   --------->ZAT18      --------->ANAC58
 
tttagggtttccttctccagaaactttgattctttcgtttttgtcggtgattgtgtcttaattctgagtgtgcatatgagagtataagctcgaaattgac  21361000
<- Previous    Next ->

AGI:  At3g57650.1   
Description:  LPAT2 (Lysophosphatidyl acyltransferase 2); 1-acylglycerol-3-phosphate O-acyltransferase. Identical to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (LPAT2) [Arabidopsis Thaliana] (GB:Q8LG50;GB:Q9SVX9); similar to LPAT3 (Lysophosphatidyl acyltransferase 3), 1-acylglycerol-3-phosphate O-acyltransferase [Arabidopsis thaliana] (TAIR:AT1G51260.1); similar to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (Lysophosphatidyl acyltransferase 2) (GB:Q6IWY1); similar to lysophosphatidyl acyltransferase [Crambe hispanica subsp. abyssinica] (GB:ABN09946.1); similar to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (Lysophosphatidyl acyltransferas
Range:  from: 21360484    to: 21364151    Orientation: Forward
Links:  TAIR  MIPS 
 
 
Please cite the corresponding publications when using AthaMap.