Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                      <---------AHL25(3)           -
                                                                      <---------AHL25(2)    --------
                                                                      --------->AHL25(2)    <-------
       --------->AHL25(2)                                            --------->AHL25(2)   <---------AHL12(1)
       <---------AHL25(1)                                            --------->AHL12(1)   <---------AHL20(2)
       <---------AHL25(2)                                            --------->AHL20(2)   <---------AHL25(3)
       --------->AHL25(1)                                            <---------AHL20(2)   --------->AHL12(1)
       <---------AHL20(2)                                            <---------AHL12(1)  <---------AHL12(3)
       --------->AHL20(2)                                            --------->AHL25(3)  --------->AHL12(3)
       <---------AHL20(3)                                            <---------AHL20(1)  <---------AHL25(1)
       <---------AHL20(1)                                            --------->AHL25(1)  --------->AHL25(3)
       --------->AHL20(1)                                   ----------->GT1  <---------GATA12    <--
       --------->AHL20(3)                                   --------->ANAC55(2)   <---------At4g35610
-->LBD16               <-----------GT1      <---------YAB1  <---------ANAC55(2)   ----------->RAV1(2)
->ANAC58          ----------->GT1  <---------MYB46(3)  <---------ICU4<---------AHL25(2)  --------->AHL25(1)
->ANAC46        ---------->DOF2   <---------AtMYB61  <---------TOE2(3)<---------AHL12(3) --------->AHL20(2)
->ANAC58--------->ATHB12       <---------AtMYB61<---------ZAT6 <-----------GT1    --------->At4g35610
actaggccattttattggtaaaagtaaaaccattttggtggtcgtctatgagtgttaagaattatgtaacaatttttttggattcacctgaaataaatct  21360100
        --------->AHL12(1)                            <---------AHL20(3)
        <---------AHL12(3)                            <---------AHL20(2)
        --------->KAN1                                --------->AHL20(3)                     -------
        --------->AHL25(1)                            <---------AHL20(1)                    ------->MYC3
       <---------AHL25(2)                             --------->AHL20(2)              <-----------GT1
       --------->AHL25(3)                            --------->YAB1                <---------DOF5.7(1)
       <---------AHL12(1)                           <---------YAB1        <---------ZAT2    ------->MYC2
       --------->AHL12(1)                          --------->TOE2(3)      --------->At4g35610-------
<---------RVE1(2)                                 <---------ICU4          <---------At4g35610-------
-------->ATHB12                                   --------->YAB1          --------->ZAT2    <-------MYC3
->GATA12<---------AHL12(1)                  --------->AtLEC2<---------AHL25(3)    <----------DOF2 --
--GATA12<---------AHL25(1)          --------->At4g35610--------->ICU4     --------->STY1(2) <-------MYC2
-------MYB52(1)               --------->RVE1(2)   --------->YAB5  ---------->DOF2 <---------DAG2----
gttgatttgaaatatttggacgttacatttccatatataagcttaccatacaaacattataattaattggaaagtccagctagcactttttaccacatgc  21360200
     <---------AHL20(2)                                     --------->WOX13(2)
     --------->AHL25(1)              --------->ARR11(3)  <---------ATHB12
     --------->AHL12(1)              --------->GATA12    <------ZmHOX2a(2)
     <---------AHL12(1)           --------->YAB1  --------->ARR11(2)
    <---------KAN1  <---------AHL25(2)            <---------ARR11(2)                            <---
-->AtLEC2    >>>>>>>>>MYB98       <-----------GT1 <---------ZAT14 ----------->RAV1(1)<---------ANAC58
-->ANAC58 <---------MYB59  =====================================HOX2a_HOX2a  --------->AHL12(2) <---
-->ANAC58--------->YAB1    <------ZmHOX2a(1)      <---------ARR14(2)       <---------DOF5.7(1) -----
------->DOF5.7(1)   --------->AHL25(1)         <---------ANAC46  --------->ANAC46    <---------ANAC58
------>DOF2------>ZmHOX2a(1)     <---------YAB5<---------ZAT6    <---------ETT(1) <-----------GT1<--
aaagggaattaatcctaacttaaaaaattaggagtaatcacatcttggtagtgtataccgatcaatttccgacagacgttttttttttccttgcccattg  21360300
                                ------>MYB46(1)      --------->ARR11(3)
                           <---------ARR11(2)        <---------ARR11(3)
------ANAC58               --------->RVE1(2)      <------ZmHOX2a(1)                        ---------
------ANAC58               <---------GATA12    --------->CCA1(2)                         --------->RVE1(2)
---->ATHB12               --------->WOX13(1)  <---------RVE1(2)                    ----------->GT1
-------WOX13(1) ---------->DOF2 -------->P   --------->CCA1(2)    <---------YAB1  ----------->GT1
attgcatagttcaaaacttcaaagttggccaatccaaccaagtcgaagagataggagatgttttgaagtatgaaaacaaatagaggggctaaaatcaaaa  21360400
                    --------->ALFIN1             --------->LBD16  --------->YAB5
                  <---------ANAC58              <---------ANAC46 <---------ATHB12
             --------->At4g35610               <---------LBD16   ------------>CBF
             <---------At4g35610         <---------YAB5  <---------YAB5--------->AHL12(3)
 --------->ANAC58 <---------ANAC58 ------>ZmHOX2a(1)  <---------AHL20(2)  --------->RVE1(2)
 --------->ANAC58 <---------ANAC55(1)   <---------ARR11(3) --------->WOX13(1)   <---------ZAT6
 ----------->GT1  <---------ANAC46--------------------->WRI1 ------------>CBF --------->LBD16<------
>YAB1 --------->DOF5.7(1)   <---------KAN1  --------->At4g35610--------->WOX13(1)  *TSS  --------->KAN1
taacaagaaaaaacgcttctgccgtgttcgaatgtgtcctcgtgatcatctccgtatataatcaatcaatcaataaaaatccagagttacaaacactctt  21360500
                                          <-----------GT1           --------->AHL20(2)
                                       <---------AHL12(2)           <---------AHL12(3)
                                      <---------AHL25(2)            --------->AHL12(1)
                                      <---------AHL20(2)            <---------AHL25(1)
                                      <---------AHL12(3)            <---------AHL12(1)
             ---------->DOF2          --------->AHL25(1)     ----------->GT1  <----------DOF2
             <---------AHL20(2)       --------->AHL12(2)     <------MYB83<-----------GT1
     <-----------GT1       <---------AHL12(2)                <------MYB46(1) <---------DAG2
   <---------AHL12(1)      --------->AHL12(2)       <-----------GT1--------->AHL25(3)
  <---------AHL25(2)       <---------WOX13(2)   <---------DOF5.7(1)<---------AHL20(2)
  --------->AHL12(2)       --------->WOX13(2)  <----------DOF2    --------->AHL12(2)
  --------->AHL20(3)     <---------AHL20(2)---------->ID1   <------MYB46(1)  <---------DOF5.7(1)
  <---------AHL12(1)  ----------->GT1<---------DOF5.7(1)    <------MYB83<-----------GT1
  --------->AHL25(2)---------->DOF2  <---------AHL12(1)   <--------P--------->AHL25(1)      <-------
---DOF5.7(1)--------->AHL20(2) <-----------GT1<---------DOF5.7(1) <---------AHL12(2)        --------
ctcaaaattttcccattaaatcgcaaagttaattttgcgattttttttctctttttttctggttgggttatttattttccccttttaaaaaacttctgca  21360600
                    --------->AHL25(2)            --------->LBD16
                    --------->AHL20(1)           <---------LBD16
                    --------->AHL20(3)          <---------LBD16
                    <---------AHL20(2)          <---------ANAC46
                    <---------AHL20(1)      <---------GATA12
                    <---------AHL20(3)      --------->ARR11(3)
                    --------->AHL12(1)      --------->GATA12
                    <---------AHL25(2)     --------->GLK1(1)
                    --------->AHL25(3) <---------HSFC1(1)                   --------------->AtSPL8
                   --------->AHL12(2)  <---------HSFB2a(2)                 <----------DOF2
                   <---------AHL12(2)  --------->HSFC1(1)        <---------ANAC46
        <---------GATA12               --------->HSFB2a(2)       <------MYB46(1)
        --------->GATA12              <---------LBD16       <---------MYB46(3)                     <
       <---------GLK1(1)    <---------YAB5 <---------GLK1(1)<-----------RAV1(1)          ------>ZmHOX2a(1)
--HSFB2a(2)   ----------->GT1--------->ATHB12  <---------LBD16   <------MYB83  <-----------GT1    <-
->HSFB2a(2)   <---------ANAC46   <---------MYB46(3)     --------->ATHB12   --------------------->WRI1
acttgtcttgaaatctggggtaaaatatttcttcattggtttctggaaatctcggggaacgatttgttgggttttcttctttgtactctctcctcacatt  21360700
            <---------RVE1(2)   --------->At4g35610
      <---------MYB46(3)      <---------WOX13(1)                         --------->ARR11(2)
      <------MYB46(1)       <---------MYB46(3)                           --------->ARR14(2)
      <------MYB83          --------->ATHB12                             <---------ARR14(2)
     <---------AtMYB61     <---------YAB1          <----------DOF2       <---------ARR11(2)        <
  <-----------RAV1(1)    <------MYB46(1)     <---------YAB5              --------->ARR11(3)        <
  <---------MYB46(3)     <------MYB83 <---------At4g35610                --------->RVE1(2)     <----
----------DOF2        <------ZmHOX2a(1)  <-----------HVH21 <---------DOF5.7(1)        <-----------HVH21
--------RVE1(2)     <---------TOE2(3) --------->ZAT2<----------DOF2     <---------CCA1(2)--------->WOX13(1)
agcttttgttggtgggattttttgaggatggtgattgctgcagctgtcatcgtgcctttgggccttctcttcttcatatctggtctcgctgtcaatctct  21360800
                                  <---------DOF5.7(1)                       <----------DOF2
                                 <----------DOF2                           <---------DOF5.7(1)
                                <---------DOF5.7(1)                  ------>ZmHOX2a(1)
                               <---------------AGL15               ------>ZmHOX2a(2)
                               --------------->AGL15              <------ZmHOX2a(2)
                              <-----------------AGL3             --------->ARR11(2)
            --------->KAN1  --------->KAN1    <---------MYB52(1) <---------ARR14(2)
     <------MYB46(1)        <-----------GT1  <-------GAMYB       <---------ARR11(2)
     <------MYB83  --------->ARR14(2)       <---------ANAC58     --------->GATA12
    <---------AtMYB61<---------ANAC46       <---------ANAC58     <---------GATA12
    --------->MYB59<---------ARR14(2)    --------->GLK1(2)       <---------RVE1(2)             <----
---------TOE2(3)   <---------ARR11(2)   <---------GLK1(2)        --------->ARR14(2)       <---------At5g28300
---------TOE1(3)   --------->ARR11(2)   <---------GATA12         --------->ARR11(3)      <----------
------DOF2 <---------YAB1<---------ZAT6 --------->GATA12         <---------ARR11(3) <---------YAB1
ttcaggtttggtttctgattcgtttctggtgttactctttttagattccgttgttgttctacattgtagatcctttcttcttttgttttgattcactgct  21360900
                <---------GLK1(2)       --------->ETT(1)
              --------->LBD16  <---------ANAC58
             <---------HSFB2a(2)        <---------DREB2C(2)                                        -
   --------->GLK1(1)           <---------ANAC58                                                  <--
   <---------GLK1(1)    <---------RVE1(2)                                                 <---------WOX13(2)
<---------TOE2(3)     <---------YAB1    <---------DEAR4(1)                                --------->WOX13(2)
<---------TOE1(3)   <----------DOF2    <---------ORA47(1)        --------->ZAT18      --------->ANAC58
------DOF2   --------->HSFB2a(2)     <-----------RAV1(1)    <---------YAB1    <---------KAN1     <--
-GT1        <---------LBD16 <----------DOF2 <---------MYB46(3)   <---------ZAT18      --------->ANAC58
tttagggtttccttctccagaaactttgattctttcgtttttgtcggtgattgtgtcttaattctgagtgtgcatatgagagtataagctcgaaattgac  21361000
<- Previous    Next ->

AGI:  At3g57650.1   
Description:  LPAT2 (Lysophosphatidyl acyltransferase 2); 1-acylglycerol-3-phosphate O-acyltransferase. Identical to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (LPAT2) [Arabidopsis Thaliana] (GB:Q8LG50;GB:Q9SVX9); similar to LPAT3 (Lysophosphatidyl acyltransferase 3), 1-acylglycerol-3-phosphate O-acyltransferase [Arabidopsis thaliana] (TAIR:AT1G51260.1); similar to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (Lysophosphatidyl acyltransferase 2) (GB:Q6IWY1); similar to lysophosphatidyl acyltransferase [Crambe hispanica subsp. abyssinica] (GB:ABN09946.1); similar to 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 (Lysophosphatidyl acyltransferas
Range:  from: 21360484    to: 21364151    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.