Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                           <---------ALFIN1         ----------->TCP11(1)
                                      <---------ARR11(3)           <---------MYB46(3)
                                    --------->ANAC58              --------->ALFIN1
                         <-----------RAV1(1)                ----------->HVH21
----ANAC58            --------->ATHB12--------->ARR11(3)    <------ZmHOX2a(2)--------->TOE2(3)     <
----ANAC46           <---------YAB5 --------->ANAC58<---------REM1(1)        --------->TOE1(3)   <--
----ANAC58   <------ZmHOX2a(1)   <------NtERF2    --------->At4g35610<---------PCF2              <--
 
tccaatggaagtgagaggagtttcttcattgttggaggcaagacctcgacctctgatgaagcgatcacggtgggccaaaaccttgaagtactccaaactt  19070600
                <-----------HVH21           --------->TGA2(2)
               ----------->GT1             <-----------HVH21
               ------>ZmHOX2a(2)           --------->TOE2(3)
             --------->ARR11(3)            <-----------TGA1
             <---------RVE1(2)            --------->ANAC46
             <---------ARR14(2)           --------->ANAC58
             --------->ARR14(2)           --------->ANAC58  <---------ZAT18
             <---------ARR11(3)      <---------WRKY18(1) <---------ANAC46
    <---------HSFB2a(2)            <---------WOX13(1)   --------->ALFIN1
    --------->HSFB2a(2)           <---------ANAC58     ------->MYC3                          -------
---------MYB52(1)      --------->TOE1(2)  --------->bZIP60(2)                    <---------HSFB2a(2)
-------ANAC58--------->GATA12     <---------AtLEC2     <-------MYC3              --------->HSFB2a(2)
-------ANAC58<---------GATA12     <---------ANAC58  <---------KAN1    --------->At4g35610 <---------ALFIN1
 
ccgttttctggcactagatcgtcaaacccaagagtttgcttgactacgtcagagaacatgtggtgaacttcgaagctaaacttcccagaagcctcacatc  19070700
                                                                                              <-----
                                                                                            --------
                      --------->MYB52(1)                                                    --------
              <------ZmHOX2a(2)                                                             <-------
             --------->ARR11(3)                                                             <-------
             --------->RVE1(2)                              --------->YAB1                  --------
             <---------ARR11(3)                            <-------TEIL                    ---------
           --------->DOF5.7(1)                   <---------ANAC58                          <--------
       XXXXXXXXXXXXXXXXXXXXX>MIR840              <---------ANAC46               <----------DOF2
  <---------ALFIN1  <---------MYB52(2)           <---------ANAC58 --------->TOE2(3)      --------->AHL20(2)
-->GATA12---------->DOF2            --------->ZAT6       --------->TOE2(3)      <---------DOF5.7(1)
 
tctccaaaccccaaaagatcaaaactaacatagacaataacacaaacacttggcgtgcaacgttcataacttcaatctcgaggcttttccgataaaataa  19070800
        ----------->GT1
      --------->LBD16                                          --------->ARR14(2)
     --------->HSFB2a(2)                                       <---------ARR14(2)
     <---------HSFB2a(2)          --------->CCA1(2)            --------->ARR11(2)
----AHL25(3)                    --------->At4g35610            <---------ARR11(2)             <-----
->AHL20(3)              --------->WOX13(2)                   <---------RAP2.6(3)              <-----
->AHL20(2)              <---------WOX13(2)                  <---------ANAC58                 -------
--AHL25(2)            --------->AHL25(1)             --------->ANAC58                     --------->DAG2
--AHL20(3)            --------->AHL20(2)             --------->ANAC58   <------ZmHOX2a(1) --------->DOF5.7(1)
->AHL25(2)            --------->AHL25(3)    --------->ZAT18 <---------ANAC58            ---------->DOF2
>AHL12(2)             <---------AHL20(2)    --------->ZAT14 <---------ANAC46   <---------TOE2(3)<---
-AHL12(2)             <---------AHL25(1)    <---------ZAT14----------------->AGL1<------ZmHOX2a(1)
 
tacaacttccagagtaaaactctgtttaatttctcagataaacgatgtacactggtacgaatgccgtatttgtaaggagattgaggaaatgaaaaggtca  19070900
                                                                                              <-----
                                                                                           <--------
                                                                                          ------>ZmHOX2a(1)
                                                                                        ------>ZmHOX2a(2)
                                                                                       <------ZmHOX2a(2)
                                                                                      --------->GATA12
       --------->KAN1                                                                 <---------GATA12
     <---------ANAC58                  <---------KAN1                                 --------->ARR14(2)
     <---------ANAC58                  --------->KAN1                                 <---------ARR14(2)
   <---------WRKY18(1)        <---------YAB1                                          --------->ARR11(2)
----WRKY38(1)            --------->KAN1<---------KAN4(1)                              <---------RVE1(2)
----WRKY12              --------->ARR14(2)                                            <---------ARR11(2)
-->WRKY18(1)         --------->HSFB2a(2)                   <---------AHL20(2)    <----------DOF2<---
------At4g35610      <---------HSFB2a(2)               ----------->GT1       <---------MYB52(1)<----
 
acagcttgacttgttcgcattgttccagacatgctgatttgaatgttcgagctaagagttgtttaatcggagtagtagccattactttggatcctcttct  19071000
              *TSS
              --------->DAG2
         --------->TOE2(3)
         <---------MYB59                           --------->WRKY12                             <---
         --------->TOE1(3)                       <---------At4g35610                           <----
       ------->TEIL                              --------->At4g35610                      <---------WRKY12
      <---------ARR11(3)                <---------LBD16                  <---------YAB1   <---------ZAT18
    --------->ANAC58                  --------->ARR11(2)              <---------MYB52(1)  <---------WRKY45
    --------->ANAC58                  <---------ARR11(2)--------->At4g35610               <---------WRKY38(1)
----DOF5.7(1) <---------TOE2(3)      --------->KAN1--------->WRKY38(1)--------->ICU4 <---------MYB52(1)
-DOF5.7(1)    --------->DOF5.7(1)  <---------DOF5.7(1)  <---------At4g35610         <-------GAMYB<--
------DOF5.7(1)               <---------GLK1(2)  <-------GAMYB       <---------RAP2.6(3) <<<<<<<<<<WRKY11
------DOF2  ---------->DOF2  <------NtERF2--------->LBD16 ----------->HVH21--------->YAB1<<<<<<<<<<WRKY6
 
ttttcccaagaacctaaaaggttgacgaaggcagagtctcttatccggagggagttgacttctgacattagccgttattaataagtctgttagtcaactc  19071100
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                            <---------CCA1(2)                                          =============
                          <---------ANAC46                                        <----------DOF2  -
                 <----------DOF2                                             <----------DOF2<-------
          --------->DOF5.7(1) <---------KAN1                       ------->GAMYB  <---------DAG2   <
    <---------LBD16--------->KAN1      --------->ZAT14            --------->MYB46(3)   <------------
-------DOF2      <---------DOF5.7(1) --------->ANAC55(2)          <---------MYB52(2)   -------------
-----DOF5.7(1)   <---------DAG2      --------->ANAC46          <---------WRKY12<-----------GT1     -
-------DOF5.7(1)<---------DOF5.7(1)<-----------GT1--------->ARR14(2)      <---------ARR11(3)<-------
 
tttttttttcggaaaaacccctttattcttcgtatatttcacttaactccctgtattctcttctgttcaacgaacaatttctttacttttctatttcgtg  19071200
      --------------->AGL15
      <---------------AGL15
     ----------------->AG
     ----------------->AGL3
     ----------------->AGL1
 <---------AHL12(2)
--------->AHL12(1)
<---------AHL25(1)
<---------AHL25(3)
--------->AHL25(2)
<---------AHL25(2)
<---------AHL12(2)
<---------AHL12(1)
--------->AHL20(2)
<---------ICU4
--------->AHL12(3)
--------->AHL25(1)
-------->AHL20(2)
---------ATHB51
---------AHL25(2)
---------AHL20(2)
---------AHL25(1)
-------->AHL12(1)
-------->AHL25(3)
---------AHL12(1)                                                                           --------
-------->AHL12(3)                                                                           --------
--ANAC58                                                                                   ---------
--->GT1------>ZmHOX2a(1)                                                                   <--------
--ANAC58                                                                                   <--------
======================MADS_MADS                                                        <---------WOX13(1)
-------->AHL25(1)                                                                     <---------WOX13(2)
--ANAC55(2)                                --------->YAB1                             --------->WOX13(2)
---------AHL12(3)                         <---------YAB1<---------At4g35610         <---------AHL20(2)
---AGL15   <---------AHL20(2)            --------->AHL20(2)                       --------->ANAC55(2)
-->AGL15 --------->WOX13(2)            <---------MYB52(1)  <---------KAN1     <---------DAG2<-------
-------->ICU4                         <---------RAP2.6(3)<---------GLK1(2)    <----------DOF2 <-----
--ANAC46 <---------WOX13(2)----------->HVH21        <-----------HVH21    <-----------GT1  <---------TOE2(3)
 
aaataatttcctatttaagtgagataacttctgacattagccgttataataagtctgtcagattatcacgaagtttatacactttatgtaattgatgatt  19071300
               <---------ARR14(2)
               --------->ARR11(2)
  --------->AtLEC2
->ATHB12       <---------ARR11(2)
->YAB5         --------->ARR14(2)
>ICU4          --------->RVE1(2)
-YAB5         --------->GLK1(1)                         <-----------GT1       --------->AHL12(2)
-YAB1------->TEIL         <---------DAG2--------->DOF5.7(1)               --------->YAB1
--ICU4 <----------DOF2    <----------DOF2      <----------ARF1           <---------ATHB12
----WOX13(1)  --------->KAN1  --------->ANAC55(2)   --------->ICU4   --------->MYB46(3)   --------->RVE1(2)
 
gctccatgcactttgacatatccaaaacactttatgtaacaaaaacaggggagacaagattaccactctcaaaccaatgaaaattgttttgcacatcaaa  19071400
                                   --------->ANAC58                                <------ZmHOX2a(1)
                                   --------->ANAC58                               <------MYB83
                                 --------->TOE2(2)                              <--------P
        --------->ANAC55(2)      --------->TOE1(2)                         --------->DOF5.7(1)
      <-----------GT1       <---------WRKY38(1)                          ---------->DOF2           <
   <---------MYB46(3)      --------->WRKY18(1)                         <---------------AGL15       -
   --------->MYB52(2)     <-----------HVH21      <---------ANAC58     ----------------->AGL1<------ZmHOX2a(1)
------------>MYB.PH3(2)  ----------->GT1         <---------ANAC58<------ZmHOX2a(1)<------MYB46(1) <-
 
cgaagtttgttactgaatgaacacaaaatggtcaaaccaaggaaaacatatggcttctgtgattcacaggaaggccaaaagaggtaggagaagtaggagt  19071500
<- Previous    Next ->

AGI:  At3g51340.1   
Description:  pepsin A. similar to aspartyl protease family protein [Arabidopsis thaliana] (TAIR:AT3G51330.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23259.1); contains InterPro domain Peptidase aspartic, catalytic; (InterPro:IPR009007); contains InterPro domain Peptidase A1; (InterPro:IPR001461)
Range:  from: 19067992    to: 19071015    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g51350.1   
Description:  aspartyl protease family protein. similar to pepsin A [Arabidopsis thaliana] (TAIR:AT3G51340.1); similar to aspartyl protease family protein [Arabidopsis thaliana] (TAIR:AT3G51330.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23259.1); contains InterPro domain Peptidase aspartic, catalytic; (InterPro:IPR009007); contains InterPro domain Peptidase A1; (InterPro:IPR001461)
Range:  from: 19071301    to: 19074489    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.