Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
--TEIL---------->DOF2                                       <-----------GT1
--ZAT18                                                 <---------AHL20(3)
-ANAC58                                           --------->YAB1     ------>MYB46(1)           <----
-ANAC58                                         --------->WOX13(2)   ------>MYB83              <----
-ANAC46                                   --------->KAN1--------->AHL20(3)                     <----
----->AtSPL3                       --------->WOX13(2)   <---------AHL20(2)                  <-------
----->AtSPL8                       <---------WOX13(2)   --------->AHL20(2)       <----------DOF2 <XX
------AtSPL8               --------->ALFIN1     <---------WOX13(2) <---------DOF5.7(1)     <--------
attaaacaagaaagctagaaacctattgaagtgttgttaatggagaaattcaattgtatttttttactcaccttcccatctaagcttttcaatgcctttc  16923900
 <---------YAB5          --------->DOF5.7(1)                     <---------KAN1
-----ANAC46              --------->DAG2                         --------->WOX13(2)
-----ANAC58       ----------->GT1   ------>ZmHOX2a(1)          --------->YAB1        ----------->RAV1(1)
-----ANAC58 --------->GLK1(2)   --------->ARR11(2)         --------->RVE1(2)       ------->GAMYB
---DOF2     --------->RVE1(2)   <---------ARR11(2)       ------->TEIL             --------->ANAC46
XXXXXXXXXXXXXXXXXXMIR825---------->DOF2--------->MYB59  <---------GLK1(2)        -------->P
-DOF5.7(1) <---------GLK1(2)    <---------ARR11(1) <---------ARR11(2)          --------->MYB46(3)
gtgcatcatcttcagaatcgaaggtgataaagccgaatcctttaggtctctgtgtttctgaatctctaataagccgagctaaacaaccccacaaacacaa  16924000
               --------->TOE2(3)                        >>>>>>>>>>WRKY38
               --------->TOE1(3)                       --------->WRKY38(1)                   <------
          ------->GAMYB                         <----------DOF2--------->DOF5.7(1)          ------>ZmHOX2a(2)
       <---------ARR11(2)                <-----------GT1>>>>>>>>>>WRKY26                  <---------RVE1(2)
       --------->ARR11(2)         <---------TOE2(3) <---------RVE1(2)               <---------RVE1(2)
       --------->MYB52(1)         <---------TOE1(3)--------->ATHB12     <---------KAN1 <---------WOX13(1)
atttagttcataaccgagccttaaacaaattcaatttcaggtttttaccttctttgatttgaccaaaaggagagaacaattgcctcagagattgatctgt  16924100
                                                     ------------------------>ANAC81     --------->TOE2(1)
                                                   --------->DOF5.7(1)          <-----------GT1 <---
                                                 --------->DOF5.7(1)      --------->DOF5.7(1)  <----
                                                 ---------->DOF2        ---------->DOF2  --------->TOE1(1)
                                            ----------->GT1          --------->YAB1--------->YAB5
      --------->At4g35610                   --------->ANAC58       --------->RVE1(2)    <-----------
-----RAV1(1)  --------->AtLEC2              --------->ANAC58  ----------------->AGL2    ------------
ggtataagcagataaccctgcaagagaacaatttcagaaaccagagcaagtaaaaagagcaagagactaaaatcagaaagaagaaaccattctcgtactg  16924200
                  --------->GLK1(2)                        <---------ARR11(2)
                 --------->GATA12                          --------->ARR11(2)
                 <---------GLK1(2)                     <---------LBD16
           --------->At4g35610                       --------->GLK1(1)
------ANAC58     <---------RVE1(2)                   <---------KAN1
->SPL7(1)  <---------ZAT2                            <---------GLK1(1)
------ANAC58    --------->KAN1       --------->ZAT6 --------->ARR14(2)                ----------->GT1
-----At4g35610 ----------->ARR10<----------DOF2--------->MYB52(1)              <----------DOF2
----AtSPL3 <---------At4g35610  --------->TOE2(3)   <---------ARR14(2)    ---------->DOF2
--->AtSPL3 --------->ZAT2      <---------DOF5.7(1)  <---------GATA12   --------->YAB1<---------TOE1(2)
cttacgaagagttgagctgagattctcttagccatctttaacagtaatccaaacggatttcggaaatgactcaaaaataaagcttttctaggttaaatgc  16924300
             <---------MYB52(1)      ------>MYB83
            <---------DOF5.7(1)      ------>MYB46(1)
          <------NtERF2            <---------MYB55(2)
         ------>NtERF2             --------->MYB46(3)
        --------->DEAR3(1)        --------->ANAC58
        <---------DEAR3(1)        --------->ANAC58
        --------->ANAC46          --------->ANAC46
       --------->ATERF1(1)        *TSS --------->ANAC58
      <---------ATERF1(1)       --------->GLK1(1)
     ----------->HVH21         <---------ARR11(2)                                         --------->ATHB12
     <---------DEAR3(1)        --------->ARR14(2)                                        <---------YAB5
    --------->SPL7(1)          <---------GLK1(2)------>NtERF2                     ------->GAMYB
   ------>NtERF2 <---------HSFB2a(2) --------->MYB52(1)                          <---------MYB55(2)
  <---------SPL7(1)            <---------ARR14(2)                                <---------MYB52(2)
  ----------->HVH21            --------->ARR11(2)                     ----------->GT1    <-------TEIL
  --------->ZAT18--------->HSFB2a(2)--------->MYB55(1)        --------->TOE1(2)  <---------MYB111(2)
<---------At4g35610--------->At4g35610 --------->ANAC58 <---------AHL20(2)       --------->MYB46(3)
--------->At4g35610<---------At4g35610 --------->ANAC46 --------->AHL20(2) <---------WOX13(2)
tcgagcggacgacgccgttttcagaagaaacacagatacccaacgaaacgacgacgtttttaaatgctgcgagaggctaattcaacaaccgattcatttg  16924400
                                                  <---------RVE1(2)       <------ZmHOX2a(2)
            <---------AHL12(2)            <---------ANAC58               --------->ARR11(2)
            --------->AHL12(2)            --------->ANAC55(2)            <---------ARR11(2)
            <---------WOX13(2)            <---------ANAC58               --------->ARR14(2)
            --------->WOX13(2)          <-----------GT1                  <---------ARR14(2)
           <---------AHL12(1)   ---------->DOF2<---------WOX13(1)        --------->GATA12
           --------->AHL12(1)--------->At4g35610  --------->GATA12       <---------GATA12         --
       ----------->GT1       <---------At4g35610  <---------GATA12 <---------GLK1(1)<---------WOX13(1)
<---------ZAT14  --------->At4g35610<---------ARR11(3)        ---------->DOF2 --------->GATA12    --
--------->ZAT14  <---------At4g35610--------->ARR11(3)      <---------TOE2(3) <---------GATA12------
cagtgaagaagagataatttagcagacgtttcagcaaaagattttacttgatagatttgatttaagaaagaaatcggatccgatttgattaacatcgcaa  16924500
                                            --------->GATA12                          <------ZmHOX2a(2)
                                            --------->RVE1(2)                         --------->CCA1(2)
                                      ------->GAMYB                                  --------->AGP1
                                      --------->YAB1                                 --------->RVE1(2)
                                   ------->GAMYB                                     --------->ARR14(2)
       --------->MYB52(1)         <---------MYB111(2)                                --------->ARR11(3)
    --------->ANAC46              --------->MYB46(3)                                 <---------ARR11(2)
    --------->ANAC58              <---------MYB55(2)                                 --------->GATA12
    --------->ANAC58        <---------WRKY38(1)                                      <---------GATA12
------->ANAC58       ---------->DOF2 --------->MYB46(3)        <-----------GT1       <---------ARR11(3)
------->ANAC58     <------ZmHOX2a(2)-------->P         --------->TOE1(3)             --------->ARR11(2)
----->RAV1(1)--------->GLK1(1) --------->MYB46(3)      --------->TOE2(3)             <---------ARR14(2)
caagaaaacgaaacagaaatcgatcaaagagtcaacaacaaccatcaaatctaaaaaaccctaattttacaaacatcgatttcaacaagatccacaattc  16924600
                   ------>NtERF2                                                               -----
                  --------->DEAR3(1)                                                     <---------KAN1
                  --------->DREB2C(2)                                                   --------->GATA12
                 --------->DEAR4(2)                                                     <---------GATA12
                 --------->ATERF1(1)                 <---------At4g35610                ------->TEIL
                <---------At5g28300                  --------->At4g35610                --------->ARR14(2)
                <---------ATERF1(1)                  --------->ZAT2            --------->ZAT14------
               <-----------GT1                       <---------ZAT2           ------->GAMYB <-------
               <---------WRKY38(1)                  --------->ANAC58       --------->MYB52(1) ------
             <-----------HVH21                      --------->ANAC58<---------KAN1     <---------GLK1(2)
         --------->TOE2(3)                 <---------KAN1     <------ZmHOX2a(1)--------->At4g35610
aagagctagtaaacttagtcaccgccttagttccttcagaaacagcatgtttcgcaagctcaccaggaagaacaagtctaacagcagtctgaatctcccg  16924700
               <---------YAB1                   ------>NtERF2
          <------NtERF2                  --------->ARR11(2)
         <---------DEAR3(2)              <---------ARR11(2)
    <---------YAB5<---------YAB1         --------->GLK1(2)
---->LBD16<---------At4g35610          --------->YAB5          --------->ARR11(3)
--------------->WRI1 <-----------GT1   --------->HSFB2a(1) ---------->DOF2  ------->TEIL      <-----
--LBD16 <---------DEAR3(1)     --------->ZAT2--------->At4g35610    <-------GAMYB     <---------ICU4
--->LBD16------>NtERF2         <---------ZAT2<---------At4g35610   <---------ANAC46--------->YAB1 <-
agaagtaatcgtcggcttcttattatacctcgcgagcttcgacgattccgatgccaatttctcaaagatgtcgttgatgaaactgttcataatccccata  16924800
<- Previous    Next ->

AGI:  At3g46020.1   
Description:  RNA-binding protein, putative. similar to RNA recognition motif (RRM)-containing protein [Arabidopsis thaliana] (TAIR:AT5G59860.1); similar to RNA-binding region RNP-1 (RNA recognition motif) [Medicago truncatula] (GB:ABN06003.1); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 16923329    to: 16924335    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At3g46030.1   
Description:  HTB11; DNA binding. Identical to Histone H2B.7 [Arabidopsis Thaliana] (GB:Q9LZT0); similar to HTB9, DNA binding [Arabidopsis thaliana] (TAIR:AT3G45980.1); similar to unknown [Populus trichocarpa] (GB:ABK93993.1); similar to unknown [Populus trichocarpa x Populus deltoides] (GB:ABK96597.1); similar to unknown [Picea sitchensis] (GB:ABK25288.1); contains InterPro domain Histone-fold; (InterPro:IPR009072); contains InterPro domain Histone core; (InterPro:IPR007125); contains InterPro domain Histone H2B; (InterPro:IPR000558)
Range:  from: 16924433    to: 16925116    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.