Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                        <------NtERF2                                --------->AHL12(2)
                                       ------>NtERF2                                 <---------AHL25(2)
            <---------At4g35610       <---------ETT(2)                               --------->AHL20(2)
            --------->At4g35610       --------->bZIP60(1)                            --------->AHL25(1)
            --------->ZAT2            <---------bZIP60(1)                       --------->ANAC58
            <---------ZAT2         <-----------RAV1(1)                          --------->ANAC58  <-
         <-------GAMYB         <---------MYB52(1)                               ----------->GT1   <-
        <---------MYB46(3)     <--------P   --------->ATHB12           ------>ZmHOX2a(1)    <-------
    <---------YAB5           <---------MYB46(3)                        --------->LBD16--------->AHL25(3)
 <---------KAN1  <---------ATERF1(1)  --------->ETT(2)      --------->ANAC58 --------->TOE1(2)    <-
-----ARR11(2)   ----------->HVH21--------->MYB52(2) <---------------------WRI1--------->MYB52(1) ---
--GAMYB<---------YAB5    --------->GLK1(1) --------->ICU4   --------->ANAC58--------->MYB46(3) <XXXX
---->GT1------>ZmHOX2a(2)<---------GLK1(1) <---------YAB1   --------->ANAC46<---------MYB52(2)<XXXXX
tagaatattgatcgttgctgcgactccgatatcggttagtgtcgccatgatttagagagaaacacacaatgttcctgaaacaaacgaaaaaaattagggt  7614100
                              <---------AHL12(3)                                                ----
                              --------->AHL25(2)                                         <------ZmHOX2a(2)
                              --------->AHL12(3)                                        --------->GATA12
       --------->TOE1(2)     <---------AHL12(1)                                         --------->ARR11(2)
--------->AtLEC2             <---------AHL20(1)                                         <---------ARR14(2)
--------ANAC58               --------->AHL20(1)                                         <---------RVE1(2)
--------ANAC58               <---------AHL25(2)                                         <---------GATA12
--TOE2(3)  <------ZmHOX2a(1) --------->AHL20(3)                                  <---------KAN1<----
--------ANAC46               <---------ARR11(3)      --------->AHL20(3)  --------->GLK1(1)  ------>ZmHOX2a(1)
------>MYB52(2)     --------->WOX13(2)      <-----------GT1          --------->HSFB2a(2)--------->ARR14(2)
XXXXXXXXXXXXXXXXMIR159B      --------->AHL12(1)     --------->AHL20(2)   <---------GLK1(1)------>ZmHOX2a(2)
XXXXXXXXXXXXXXXMIR159A       --------->AHL25(2)     --------->AHL25(3)--------->LBD16   <---------ARR11(2)
tccttgcaatccaaggacttccaaattgccaatatttttagctagtttttctccataaatttctcgtttcacccagaaatcggaatttttggatcctagt  7614200
         <---------At4g35610                                                           --------->DAG2
   <----------DOF2  --------->GATA12                   --------->KAN1                 ---------->DOF2
  <---------DOF5.7(1)                                 <---------YAB5           --------->CCA1(2)
----->YAB1<---------ARR14(2)             --------->ZAT6--------->YAB5     ---------->DOF2     <-----
-----YAB5--------->KAN1   --------->AHL20(2)       --------->ATHB12  ------->TEIL <---------ZAT6
catagtcttttcagattccgtcaaatccattaaacactgaatcaactctacaaatgagtgattcttcacatgaatgtgaaagatagagataaagtttaag  7614300
              --------->At4g35610                                                 <------ZmHOX2a(1)
    <----------DOF2                                                          <---------KAN1
   <---------DOF5.7(1)                                               --------->At4g35610         >>>
   <---------DAG2         ------->TEIL             --------->ZAT14   <---------At4g35610   >>>>>>>>>TBF1
<-----------GT1  ---------->CDC5                   <---------ZAT14--------->WRKY38(1)  =============
----TOE2(3)  <---------ARR11(3)          <-----------GT1         <XXXXXXXXXXXXXXXXXXXXMIR858  >>>>>>
tttttacctttctcaagagctcagcgatgaaactcgtcttgttgtttctatctgtgaagtcaaacaacgttgagcagagaatgaaggagaggaagaagaa  7614400
                                           --------->AHL20(2)      *TSS
                                           <---------AHL20(2)  <---------ANAC46
                                           <---------AHL20(3)  <---------ANAC58
                                       --------->YAB1  --------->AHL25(3)                          <
                                <---------ARR11(2)    --------->AHL12(2)                        ----
      --------->ICU4        --------->At4g35610     <---------RVE1(1)                          <----
>>>>>>>>>TBF1        --------->DOF5.7(1)   --------->AHL20(3)  <---------ANAC58            ------>ZmHOX2a(2)
>>>>>>TBF1         ---------->DOF2    <-------TEIL <---------RVE1(2)                     <---------GATA12
=======================HOX2a_HOX2a --------->KAN1  <---------ARR11(3)                <------------CBF
>>>TBF1         <------ZmHOX2a(2) <---------YAB5   --------->ARR11(3)                <---------WOX13(2)
gaagaagaaagtattagggatcaaaagaagaagcagaaacattcataaaaatgagatttttaatttgtgtgtttgggtttattttggaaattgatccaaa  7614500
                   <---------At4g35610                --------->AHL20(2)
       =========================================MYC_MYB <---------WOX13(2)
       <---------TGA1a                                --------->AHL25(3)
     --------->ZAT14                                  <---------AHL20(2)
     <---------ZAT14                      <-----------GT1--------->AHL25(3)
    ------->GAMYB  --------->At4g35610  <-------GAMYB --------->AHL20(3)               <------ZmHOX2a(1)
    =============MYC_MYB             <---------ANAC46 --------->AHL25(1)               --------->YAB5
  <---------At4g35610        <---------TOE1(2)        <---------AHL25(3)           --------->TOE1(2)
  --------->At4g35610    <-------TEIL<---------ANAC58 <---------AHL25(1)          --------->DEAR3(2)
-------TEIL   --------->GLK1(1)      <---------ANAC58--------->AHL25(3) --------->WOX13(2)
----->YAB5    <---------GLK1(1)    <---------ANAC46  --------->AHL20(2) <---------WOX13(2)      ----
-----ATHB12  --------->GATA12<---------TOE2(2)   <-------TEIL--------->AHL25(3) --------->MYB52(1)
gattcaactgaagtgagatttctgctgattcatacgttttgggtgttacaagtccatttaattaattaattaactaatttagcgaaccgaggattaaacg  7614600
                      <---------AHL20(2)                            --------->AHL25(3)
                      <---------AHL20(3)                            <---------AHL25(1)
                      <---------AHL25(3)                            <---------AHL20(2)
                     <---------AHL12(1)                             --------->AHL25(1)
             ---------->DOF2                                        --------->AHL20(2)
      <---------ZAT2 <---------AHL25(1)                             --------->AHL12(3)
      --------->At4g35610            --------->DAG2                 <---------AHL20(3)
      <---------O2   --------->AHL25(3)                  <------ZmHOX2a(1)
      ==================bZIP_DOF <---------WOX13(2)    <---------TOE2(3)
      <---------At4g35610        --------->WOX13(2)    <---------TOE1(3)<---------WOX13(1)
      --------->ZAT2 --------->AHL12(1)            <---------WOX13(2)  --------->WOX13(2)
      <---------TGA1a--------->AHL25(1)            --------->WOX13(2)  <---------WOX13(2)
      --------->O2   --------->AHL20(2)            --------->AHL12(2)<---------AHL20(2)
      ----------->RAV1(2)   <---------ZAT6    <---------ZAT6<---------KAN1        <-----------RAV1(1)
  <------ZmHOX2a(1)  <---------AHL20(2)       ----------->GT1       --------->AHL20(3)      <------ZmHOX2a(1)
----->At5g28300--------->DOF5.7(1)  ---------->DOF2<---------AHL12(2)<---------YAB1 ---------->ID1<-
gtgaaggacacctggcaaaagagattaatttgtgttaaataaagtaatagtgttaattaaggaatttgtattttaattgaatgttttgttgtttaggaca  7614700
              <---------DOF5.7(1)       --------->YAB1
   <---------MYB52(1)                   <---------ICU4                                             -
   <<<<<<<<<MYB98                      <---------ATHB51                                            <
  <-------GAMYB                        <---------ATHB12                                          <--
 <---------MYB46(3)                    --------->ICU4 --------->TOE2(3)                         ----
 --------->MYB52(2)               --------->ANAC58    --------------------->WRI1          <-------TEIL
--------->SPL7(1)         <----------DOF2 <---------YAB5                           <---------WOX13(2)
--------SPL7(1)<----------DOF2    --------->ANAC58 <-----------GT1            ----------->GT1  <----
tcgtccgttactgggttccttttcagtttctttagagaagcaataatggtttattagccttataggtctcgccgtattagcatgttatttatgttcatat  7614800
                                         <---------AHL12(1)                                <--------
             <---------AHL20(2)          --------->AHL12(3)                                ---------
     <----------DOF2                     --------->AHL12(1)                               --------->DOF5.7(1)
--------->RAP2.6(3)     <---------TOE2(3)<---------AHL20(3)                              --------->DOF5.7(1)
-------->MYB52(1)       <---------TOE1(3)<---------AHL12(3)                              ---------->DOF2
-----------GT1         <-----------GT1  --------->AHL25(3)                       <<<<<<<<<MYB98
-------AHL20(2)        <---------DOF5.7(2)<---------AHL12(2)                   ----------->GT1
----->YAB1   <---------RVE1(2)        ------->TEIL<---------LBD16              <---------YAB1      <
-----YAB1  <---------AHL20(2)     <---------TOE2(3)  --------->ATHB12 <------ZmHOX2a(1) --------->DOF5.7(1)
tataacggctgtattttatattggtttaacgttttctaatgtatttatttattccctgatttgaaagtttagaggacacattatgttaaaaaaaaaggtt  7614900
       <----------DOF2                                                   <---------AHL25(3)
   ----------->HVH21                                                     <---------ICU4
  ------>ZmHOX2a(2)                                                     --------->AHL25(1)
 --------->At4g35610                                                    <---------AHL25(1)
 <---------At4g35610                                                    --------->AHL25(3)
 <------ZmHOX2a(2)                                                      <---------AHL12(3)
 --------->CCA1(2)                                                      --------->AHL12(1)
<---------RVE1(2)                                                       <---------AHL12(1)
--------->ARR14(2)                                                      --------->ICU4 -------------
--------->AGP1                                                          --------->AHL12(3)
--------->ARR11(3)              <---------AHL12(2)                      <---------ATHB51
<---------ARR11(3)              --------->AHL12(2)           <---------ANAC58    --------->ANAC55(2)
--------->GATA12               --------->AHL25(1)            <---------ANAC46    <---------ANAC58
<---------GATA12               <---------AHL20(2)      <----------DOF2  <---------AHL20(2)    <-----
<---------ARR14(2)        <---------YAB1         ----------->GT1        --------->AHL20(2) ---------
<---------AGP1      --------->DAG2         <---------WOX13(2)<---------ANAC58    <---------ANAC58  -
-TOE2(3)       <---------KAN1 --------->AHL25(3)<---------TOE2(3)     --------->WOX13(2)  <---------ATHB12
>DOF5.7(1)--------->HSFB2a(2) --------->AHL20(2)<---------TOE1(3)   --------->AHL20(2) <------------
---------GLK1(1)   ---------->DOF2      <---------YAB5 <---------DAG2 --------->AHL12(2)  <---------ATHB51
tgagatctgacttttggaatgaaaaagttttgatttaatattagtcagtttaaggtaactttttgtgtgttttaaataattattccgttacaaataatgg  7615000
<- Previous    Next ->

AGI:  At3g21620.1   
Description:  early-responsive to dehydration protein-related / ERD protein-related. similar to early-responsive to dehydration protein-related / ERD protein-related [Arabidopsis thaliana] (TAIR:AT4G22120.4); similar to early-responsive to dehydration protein-related / ERD protein-related [Arabidopsis thaliana] (TAIR:AT4G22120.5); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G15430.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24038.1); similar to [Lotus japonicus] (GB:BAF98597.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69661.1); contains InterPro domain Protein of unknown function DUF221; (I
Range:  from: 7610965    to: 7614468    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.