Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                          <-----------GT1
                                       --------->WOX13(2)
                                       <---------WOX13(2)
                                     <---------AHL20(3)
                                     --------->AHL25(1)
                                     <---------AHL25(1)
                                     --------->AHL20(3)
                                     <---------AHL20(2)
                                     --------->AHL20(1)
                                     <---------AHL20(1)
                                     --------->AHL20(2)
                                   --------->AHL12(2)
                                   <---------AHL12(2)
                                  <---------AHL25(2)
                                  <---------AHL12(2)
                                  <---------AHL25(3)
                                  <---------AHL12(3)
                                  --------->AHL20(1)
                                  --------->AHL25(2)
                                  <---------AHL20(3)
                                  --------->AHL20(3)
                                 <---------AHL12(1)
                                 --------->AHL12(1)
                                 <---------AHL20(2)
                                 --------->AHL20(2)
                                 <---------AHL25(1)
                                 <---------AHL12(3)
                                 --------->AHL25(1)
                                 --------->AHL12(3)
                                 --------->AHL25(2)
                                 <---------AHL25(3)
                                 --------->AHL25(3)
                                 <---------AHL25(2)
                                <---------AHL20(2)
                                --------->AHL12(1)
                                <---------AHL20(1)
                                <---------AHL12(1)
                                --------->AHL25(1)
                                --------->AHL20(2)
                                --------->AHL25(2)
                                --------->AHL25(3)
                         <---------ARR11(2)                            <---------DOF5.7(1)
    <---------YAB5       --------->ARR11(2)                  --------->ATHB12
------->YAB5       --------->ARR11(3)--------->AHL25(3)     <---------YAB1
>YAB1              --------->AHL20(1)--------->AHL25(2)     --------->ICU4
-ICU4--------->YAB5<---------AHL25(3)<---------AHL25(3)     <---------YAB5          --------->YAB5
>ATHB51           --------->AHL20(2) <---------AHL25(2)--------->YAB1 <----------DOF2
---->WRI1         <---------KAN1<---------AHL25(2)   <---------ZAT14 <---------DOF5.7(1)       -----
 
ctgattactgattcacatcaaatatatggttccaaattattttattaactcaagtgtatagtaatgtttgactcttttttctgcaaatgtttcgaagaca  5243100
                                                                                                 ---
                                                                                                 <--
                                                                                          <---------ICU4
                                                                                       --------->YAB5
                                                                                       --------->YAB1
                                                                                       --------->ATHB12
                                                     <---------TOE2(3)        <---------AHL20(2) <--
                                                 <---------AHL12(2)        --------->WOX13(2)    ---
                                              <---------YAB1               <---------WOX13(2)    ---
                                            --------->YAB5               <---------AHL20(2)      <--
                                    <---------ZAT6  <-----------GT1      --------->AHL25(3)      ---
                       <---------YAB1      <---------YAB1                --------->AHL20(2)    <----
       <---------TOE2(3)--------->YAB1   <---------At4g35610  --------->WOX13(1)       <---------ICU4
----->DOF2     --------->YAB1    ---------->ID1--------->AHL20(2)     <----------DOF2 <---------ATHB12
 
aagtgctattaagttttatcaaaactatgatgttttgtagttttagatgattatataacgtttgtcaatctgtcttttaatttacttaaatcattagggc  5243200
           --------->WOX13(2)
           <---------WOX13(2)
         --------->AHL20(3)
         <---------AHL20(3)
         --------->AHL25(1)
         <---------AHL25(1)
         <---------AHL12(3)
         --------->AHL12(3)
         --------->AHL20(2)
------>ANAC58
-------At4g35610         <---------RVE1(2)                                                <---------DAG2
----MYB46(1)   <---------AHL12(2)                            ----------->GT1--------->AtLEC2
-------->GT1  --------->AHL20(2)                        <---------AHL20(2)  --------->ANAC58
------>ANAC58--------->AHL20(2)                     ----------->GT1         --------->ANAC58      --
----MYB83<---------AHL20(2)  <---------ANAC46      ------->MYC3        <-----------GT1    <---------
------>At4g35610  --------->MYB52(1)               <-------MYC3     <---------AHL12(2) <---------AHL20(2)
-------RAV1(2)<---------AHL25(3)             <---------AHL25(3)    <---------AHL12(2)  <-----------GT1
 
aggtaactatatttaaataaaaaacagagattgtgtatgagtttgaaataaaaacgtgttaaaatggaaaaaataaaccatgccaagtatttactttact  5243300
                                                                                                  <-
                                                                                                ----
                                                                                                <---
                                                                                               -----
                                                                                               <----
                   <---------ICU4  <---------TOE1(2)                                           <----
                  <---------KAN1<---------ANAC46                                               -----
                  <---------AHL12(1)                     ----------->GT1                --------->CCA1(2)
                  --------->AHL12(1)                  --------->YAB1                   --------->ARR14(2)
                <---------GLK1(2)<---------SPL7(1)    -------->HAHB4  --------->GLK1(2)<---------RVE1(2)
          --------->ZAT14       <---------ANAC58     --------->ICU4 --------->KAN1     --------->GATA12
          <---------ZAT14       <---------ANAC58     <---------YAB1<---------RVE1(2)   <---------GLK1(2)
      --------->DAG2         --------->bZIP60(1)----------->GT1  ----------->ARR10<---------WOX13(2)
     --------->DOF5.7(1)--------->ANAC55(2)     <---------ANAC55(2)<---------ARR11(3)  <---------GATA12
-------->DOF2--------->ANAC46<---------bZIP60(1)--------->ANAC55(2)--------->ARR11(3)----------->ARR10
-DOF2---------->DOF2  <-----------GT1    <-----------GT1 --------->YAB1  <---------HSFB2a(2)  ------
 
acaaaggaaaaagtatacagaatttttacatgatgtcgtatgaattacatcatgtaataatagtaacttagatattctgtaagaaaattagatttgcata  5243400
       <---------ARR11(2)
       --------->ARR11(2)
       --------->RVE1(2)
       <---------ARR14(2)
       --------->ARR14(2)
      --------->KAN1
 --------->TOE1(3)
 --------->TOE2(3)
<---------ANAC55(2)   --------->AHL25(1)
----------->GT1       ----------->TBP
<---------ANAC46      <---------AHL20(3)
----------GT1         <---------AHL12(3)
----->WOX13(2)        --------->AHL20(3)                                  --------->KAN1
------WOX13(2)        --------->AHL20(2)                                <-----------GT1          <--
---->YAB5             <---------AHL20(2)                            <-----------TBP             ----
-----ICU4             --------->AHL12(3)                         <---------ANAC58             ------
----HAHB4             <---------AHL25(1)     <------ZmHOX2a(1)   <---------ANAC46      ---------->DOF2
---->ATHB51     ----------->GT1   ---------->DOF2                <---------ANAC58   --------->AHL20(2)
--->ICU4   --------->LBD16    ---------->DOF2----------->GT1<------------CBF        <---------AHL20(2)
 
attacgttaatatccgagggtgtatataaataagaaagaaagaacagaggattaaaacccacaaattggcgttttatacatccccatttaaaaagaatgg  5243500
                                                                                        --------->AHL12(3)
                                        --------->ANAC46                                --------->AHL20(2)
   ------>NtERF2              <---------DOF5.7(1)                                       <---------AHL12(3)
  --------->RAP2.3(3)        <---------DOF5.7(1)                                        --------->AHL20(3)
  --------->DEAR3(1)     <---------ALFIN1                                               --------->AHL25(1)
 --------->ORA47(2)     --------->At4g35610                                             --------->AHL25(2)
-------DOF5.7(2)        <---------At4g35610----------->RAV1(1)                          <---------AHL20(3)
----->ARR11(2)   <---------KAN1<----------DOF2                            <-----------GT1
--->YAB1        *TSS<-----------GT1 <----------DOF2           --------->YAB5 --------->YAB5
 
taacgccgactctgtgaagcatttttcagcactcctttcctttcccccacaaactaaacaaaaaaccattaacaaaaaaaccattcacaaaaaaaataga  5243600
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                               <---------ARR11(3)
                                                                               --------->ARR11(3)
                                                                              --------->CCA1(1)
                                                                              <---------RVE1(1)
                                                                              <---------CCA1(1)
                                ------>ZmHOX2a(2)                             --------->GLK1(1)
                     --------->YAB1                                           --------->RVE1(1)
             <---------ZAT14    ===================HOX2a_HOX2a                <---------GLK1(1)
    ----------->RAV1(2)     <---------YAB1                                   --------->ARR11(3)
    <---------At4g35610   --------->CCA1(2)                                  <---------ARR11(3)
    --------->At4g35610<---------YAB1                      --------->TOE1(2) <---------RVE1(2)
  --------->YAB1    <---------ZAT6                         --------->TOE2(2)<<<<<<<<<RAP2.2  <------
 <---------YAB5     --------->ICU4          ------>ZmHOX2a(1)    <------ZmHOX2a(2)   <---------HSFB2a(2)
--------->GLK1(2)   <---------YAB5          ============================HOX2a_HOX2a  --------->HSFB2a(2)
 
gagaatcatctgagagagtagtagtgatgatatgatcgcttcttctcctacaatctcagaaacctccgatcacggttttagatatcttctacaacggata  5243700
                                           ------>MYB46(1)
                                           ------>MYB83
                                           --------->MYB52(1)
                                     --------->MYB46(3)
                                 ------>NtERF2
                                 --------->ABI4(1)
                                --------->DEAR3(1)
                                ------->GAMYB
                                --------->ANAC58
                                --------->ANAC46
                                --------->ANAC58
                                --------->RAP2.6(2)
                             <---------ALFIN1--------->HSFB2a(1)
                             --------->DEAR3(1)                            --------->DEAR3(1)
                             --------->AtMYB61                            --------->DEAR3(2)
                            --------->MYB46(3)                            --------->MYB46(3)
                        --------->PCF5   <---------MYB111(1)             ------>MYB83
                   --------->LBD16 <---------ALFIN1                      -------->P
                 <---------LBD16--------->DREB2C(2)                      ------>MYB46(1)
     <---------ZAT14 --------->ALFIN1<---------ALFIN1                    --------->MYB52(1)
     --------->ZAT18 <---------AtMYB61   <---------MYB59           <-----------GT1
     --------->ZAT14<---------MYB52(1)   --------->AtMYB61      --------->ARR14(2)           <------
     <---------ABI4(2)<---------MYB46(3) <---------MYB46(2)     <---------ARR11(2)   <---------ANAC58
---ARR14(2)  --------->HSFC1(2)--------->MYB46(3)             --------->LBD16      <---------ARR11(3)
-->ARR14(2)  --------->HSFB2a(1)--------->DEAR4(1) ------>ZmHOX2a(1) --------->ANAC46<---------ANAC58
-->ARR11(2) --------->ARR14(2)--------->ABI4(1) ------>MYB83<---------LBD16------->GAMYB     -------
---ARR11(2)<---------GLK1(2)<---------MYB55(2)  ------>MYB46(1) --------->ARR11(2) --------->ARR11(3)
 
caatggagagcaccgattcttccggtggtccaccaccgccacaacctaaccttcctccaggcttccggtttcaccctaccgacgaagagcttgttgttca  5243800
                                                                                               -----
                                                                                              ------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                          ----------
                                                                                          <---------
                                                                                          ----------
                                                                                          <-------TEIL
                                     <------NtERF2                                      <---------MYB52(1)
                                    ------>NtERF2                                      --------->LBD16
                                   <---------ETT(2)                              --------->HSFB2a(1)
                                   --------->ETT(2)                             --------->HSFB2a(1)
                                 <-----------HVH21                              <---------HSFC1(2)
                                <-----------RAV1(1)             <---------AHL20(2)    --------->LBD16
      --------->ANAC46        ----------->RAV1(2)               <---------AHL20(3)   <---------LBD16
      --------->ANAC58    <---------DOF5.7(1)                  --------->AHL20(2)<---------KAN1-----
      --------->ANAC58    <---------DAG2                 ------>ZmHOX2a(2)      --------->HSFC1(2)
--------->TOE2(3)         <----------DOF2      --------->DEAR3(1)     --------->GATA12--------->ANAC46
--------->TOE1(3)    --------->At4g35610 --------->YAB1<---------GATA12         <---------HSFB2a(1)-
---ZAT18             <---------At4g35610 <---------ICU4--------->GATA12 ------>ZmHOX2a(2) --------->SPL7(1)
-->ZAT18 ---------->DOF2 <---------DOF5.7(1)--------->DEAR3(1) --------->AHL25(3)<---------HSFB2a(1)
 
ctacctcaaacgcaaagcagcctctgctcctttacctgtcgccatcatcgccgaagtcgatctctataaatttgatccatgggaacttcccggtacgtac  5243900
      <---------YAB5
      <---------YAB1
    --------->YAB1
    <---------ICU4
   <---------YAB5
---->ANAC58
--->SPL7(1)
->TOE2(2)                                                                                    -------
->TOE1(2)                                                            <----------DOF2         <------
--SPL7(1)           --------->YAB5                  --------->AHL20(2)                 <---------ARR11(3)
>ANAC58  <---------YAB5                             <---------AHL12(3)                 --------->RVE1(2)
-ANAC58  <---------YAB1                             <---------AHL20(3)                 <---------GATA12
-ANAC55(2)<---------ICU4                            <---------AHL20(2)               <---------YAB1
>ANAC55(2)--------->YAB1                       <---------AHL20(2)    <---------DOF5.7(1)     -------
>ANAC58--------->YAB1                     <---------YAB1            <---------DAG2 --------->YAB5
-ANAC58<---------ICU4          --------------->AGL15--------->AHL25(1)             --------->YAB1
----->AtSPL8 --------->YAB1    --------->AHL20(2) <---------WOX13(1)<---------DOF5.7(1)--------->ARR11(3)
------AtSPL3 <---------ICU4    <---------------AGL15<---------AHL25(1)<---------DOF5.7(1)------>ZmHOX2a(2)
----->AtSPL3<---------YAB5<----------DOF2 --------->AHL25(3)     <-----------GT1  --------->ICU4
---->ANAC58 <---------YAB1<---------DAG2<---------ZAT6          ----------->HVH21 <---------YAB1<---
-------->AtMYB61   --------->MYB46(3) ----------->GT1      ------->TEIL<---------DOF5.7(1)  <-------
 
gacctcatcatcatcatcatcaacaactacttttttatatatagtattatttgatttatatgaatttgtgaccttttttttggttatgatgatctaaatc  5244000
<- Previous    Next ->

AGI:  At3g15510.1   
Description:  ATNAC2 (Arabidopsis thaliana NAC domain containing protein 2); transcription factor. similar to NAM (Arabidopsis NAC domain containing protein 18), transcription factor [Arabidopsis thaliana] (TAIR:AT1G52880.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39227.1); contains InterPro domain No apical meristem (NAM) protein; (InterPro:IPR003441)
Range:  from: 5243517    to: 5245389    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.