Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  <---------O2  --------->ARR11(2)
                    --------->ARR14(2)            --------->ANAC46     --------->GATA12
                   --------->ARR14(2)             --------->TGA1a      <---------GATA12            -
------>DOF2        <---------ARR11(2)           <---------ALFIN1<---------ARR11(2)    --------->At5g28300
--->TOE2(3)        <---------GLK1(2)   =====================bZIP_DOF  --------->REM1(1)          <--
--->TOE1(3)        <---------ARR14(2)  <----------DOF2  --------->WOX13(1)           ----------->GT1
aaagcccaaaatatggagggccgattcttcatcttctcacttctttttcttccacgtgtcaagcacggaaactacatccaatctcagaccgtaaaactaa  5208600
                         --------->LBD16                  --------->AHL25(2)
                     <---------ARR11(2)                   --------->AHL25(3)            <---------ZAT6
                     --------->ARR11(2)                   --------->AHL20(3)      --------->DAG2
                  <------NtERF2                           <---------AHL25(1)     ---------->DOF2
    --------->ARR11(3)  ----------->GT1                   <---------AHL20(2) --------->ANAC46
    <---------RVE1(2)--------->ARR14(2)                   <---------AHL20(1) --------->ANAC58
    <---------ARR14(2) <---------LBD16                    <---------AHL25(2) ------>MYB46(1)
    --------->ARR14(2)--------->MYB52(1)           <-----------GT1<XXXXXXXXXXXXXXXXXXXXMIR778
   <------ZmHOX2a(1) <---------ARR14(2)    <-----------GT1--------->AHL20(2) --------->ANAC58  <----
-------->LBD16   --------->LBD16         <---------MYB52(2)<---------AHL12(1)--------->AtLEC2  -----
-------LBD16   <---------LBD16      --------->AtLEC2      --------->AHL25(1) ------>MYB83  <--------
accggaggattttgtgaagccggagaaccggaaatagttatgcaaataaccaagttaccaatttaatttgaacataaaccaagcaaaagtagtggtgaag  5208700
                                                    ------>NtERF2  --------->TOE2(3)
                                   --------------->AtSPL8       --------->ANAC58                   -
                                   <---------------AtSPL8       --------->ANAC58                   -
                             --------->AHL20(2)     <---------ATERF1(1)                        -----
                             ---------->DOF2       --------->DEAR3(1)                          <----
                       --------->ANAC58            --------->RAP2.3(3)      --------->GLK1(2)  <----
                       --------->ANAC58           --------->DEAR3(2)       <---------GLK1(2)   -----
-----At4g35610       ---------->DOF2              --------->RAP2.3(1)      --------->ARR11(3)  -----
---->At4g35610    <---------At4g35610            --------->At4g35610     --------->DOF5.7(1)  <-----
-REM1(1)          --------->At4g35610  <-------TEIL----------->HVH21   ---------->DOF2      <------ZmHOX2a(1)
cagaaaacacataaaactctcagctaaagcaataaaacagagtacattcaagagccgacgactaagtaagcctcaaaagattctgcaaacagagaggaac  5208800
        --------->DOF5.7(1)    <---------AHL20(2)               ====================================
      ---------->DOF2     <---------ARR14(2)                    <---------TGA1a
    --------->ANAC58      <---------ARR14(3)                    ====================================
    --------->ANAC58      --------->ARR14(3)                    ===============bZIP_DOF
    --------->ANAC46      --------->ARR14(2)                    --------->ANAC46
   ------>NtERF2          <---------RVE1(2)                     <---------O2
------>GAMYB              <---------ARR11(3)                    --------->ANAC58
-------->ANAC46           --------->ARR11(3)                    --------->TGA1a
---->KAN1                 <---------AHL20(1)                    --------->O2                     <--
-----KAN1                 --------->AHL20(1)                    --------->ANAC55(2)           ------
-----HSFB2a(1)          --------->ANAC58                        --------->ANAC58              <-----
---->MYB46(3)           ----------->ARR10      <-----------GT1  --------->ANAC55(1)        ---------
---->KAN4(1)            --------->ANAC58    --------->WOX13(2)<---------ALFIN1            ----------
----KAN4(2)      --------->DOF5.7(1)<-----------GT1        ------>ZmHOX2a(1)          <---------AHL20(2)
aatcgccacgaaagaagcttaagaggcaagatattgaattttcccctaattttctattcgtcctcacacgtctttcaccattctcttatataaaaaagtt  5208900
                                                            <-----------RAV1(2) <---------MYB52(2)
                                       --------->DOF5.7(1) <-----------------AGL1  -------->P
                                       --------->DAG2   <----------DOF2       --------->ZAT6
                                      ---------->DOF2  <---------ANAC58 --------->WOX13(1)
========bZIP_DOF                   ------->GAMYB  <----------DOF2    <---------ARR14(2)
=bZIP_DOF                         --------->MYB46(3)   <---------ANAC58------>ZmHOX2a(2)           -
--------DOF2                     --------->ANAC58 <---------DOF5.7(1)--------->RVE1(2)             <
--->ARR11(3)                     --------->ANAC58<---------DOF5.7(1) <---------GATA12   <----------DOF2
----ARR11(3)                <---------ZAT18      <---------DAG2 <--------P --------->YAB1     <<<<<<
>DAG2 <----------DOF2       --------->ZAT18    --------->ARR11(3)    --------->GATA12   <---------DOF5.7(1)
>DOF2 <---------DAG2     <---------ANAC46      <---------ARR11(3)   <------ZmHOX2a(1)  <---------DOF5.7(1)
ctttttagactttttggtttcatttgtttagtgggcaaccaaaaagtcaagaccttttgctttccaggtaaggatctatcaccactaacctcttttcttc  5209000
                                                                      <---------RVE1(2)          ---
                                                            <---------DOF5.7(1)         <---------ANAC58
        --------->TOE1(1)                                   <---------DAG2              <---------RVE1(2)
   --------->ARR14(2)        --------->WOX13(2)             <---------------AGL15       <---------ANAC58
   --------->ARR11(2)        <---------WOX13(2)             <----------DOF2            --------->ATHB12
-------->HSFB2a(2)        ------------>CBF                 <---------DOF5.7(1)       <---------WOX13(1)
---------HSFB2a(2) <-----------GT1------->TEIL           ---------->ID1            --------->ATHB12
<<<TBF1------>ZmHOX2a(1)  *TSS    <---------TOE1(2)     <-----------GT1           <---------YAB1 ---
ttctcgattcctcgttccctattttcgatttcaattgtacgtttttcaatcgaaagttttctcctttttgagggatttgtttagtttgattgattgtgga  5209100
                                                          <------ZmHOX2a(2)          <---------RVE1(2)
                                                          <---------At4g35610        --------->GATA12
                                                          --------->At4g35610        --------->ARR11(2)
                                                         --------->GATA12            <---------ARR11(2)
                                                <---------GLK1(2)                    --------->ARR14(2)
                                              <---------YAB5                         <---------GATA12
                                     <-----------RAV1(2) <---------GATA12            <---------ARR14(2)
                                  --------->REM1(2)<---------ANAC58      --------->YAB5
                               <---------ANAC58 <---------RVE1(2)        --------->ATHB12
                               <---------ANAC55(1) <---------ANAC58      <---------ICU4       <-----
                               <---------ANAC58--------->KAN1           <---------YAB5 ------>ZmHOX2a(2)
                               <---------ANAC46--------->YAB5           <---------YAB1--------->KAN1
                          <---------KAN1     <---------WOX13(1)         --------->ICU4<------ZmHOX2a(2)
                         --------->ARR14(2) >>>>>>>>>GATA-1           --------->YAB1 --------->ARR11(3)
-------KAN4(1)           --------->GLK1(2)  >>>>>>>>>GATA-2      <---------DOF5.7(1) <---------ARR11(3)
------>KAN4(1)           <---------ARR14(2) >>>>>>>>>GATA-3 ----------->HVH21   --------->ARR11(2)
------>KAN1             <---------GLK1(2)   >>>>>>>>>GATA-4------>ZmHOX2a(2)    <---------ARR11(2)
ttgttctgttcttcgttgcagttcgaagaatctggcgtgttcaggtggattgattcttgcgatctgacccttctcatgattagtttccgatcttcgaata  5209200
         --------->ARR14(2)                                   --------->MYB46(3)
         <---------ARR14(2)                                   <---------MYB55(2)
         <---------GLK1(2)                              <-----------GT1
   ------->GAMYB                            <---------ANAC58 ------>MYB83
 --------->ZAT2                             <---------ANAC58 ------>MYB46(1)
 ------>MYB83                     ------>ZmHOX2a(1) <----------DOF2
 ------>MYB46(1)               <-----------GT1     <---------DOF5.7(1)
--------->MYB52(1)          <---------DOF5.7(1) <---------CCA1(2)  ------->MYC3
----KAN1--------->KAN1      <---------MYB52(1)<---------CCA1(2)    <-------MYC3
gaccaactgcgagattctcatctataactccgttttcctattcgatttcttatctctttctaccatccaacgtgttcttcatacattacttcaattgctc  5209300
                 <---------ARR14(2)                                 <------MYB83
                 --------->ARR14(2)       ---------->DOF2           <------MYB46(1)
                 --------->ARR11(2)     ------->GAMYB           <---------WOX13(2)
                 <---------RVE1(2)    -------->P                --------->WOX13(2)
                 --------->GATA12     --------->ANAC58       <-------TEIL
            <-----------ARR10         --------->ANAC58    <---------ANAC58
            --------->GLK1(2)     --------->ANAC58        <---------ANAC58
            <---------ARR11(3)    --------->ANAC46     <---------MYB52(1)
            <---------GATA12 <---------ANAC46         ------>ZmHOX2a(1)
            --------->GATA12 <---------ANAC58         <----------DOF2                              <
            --------->RVE1(2)<---------ANAC58        <---------DOF5.7(1) --------->ICU4            =
            --------->ARR14(2)    --------->ANAC58 ---------->ID1  --------->MYB59               ---
tcgatttcgcctcaaaatctgatcctctagtagcttgaagcaacccaaagtctcgtcctttacgttcaattaggtcattttgaaaccctgttcttagaat  5209400
                                            <---------ARR11(2)             <---------WRKY18(1)
                                            <---------RVE1(2)             --------->WRKY38(1)     <-
                                           ===========================HOX2a_HOX2a                <--
                   ===============================HOX2a_HOX2a             --------->WRKY12      <---
      ----------->ARR10                    <------ZmHOX2a(1)           --------->ALFIN1       <-----
      --------->ANAC58             <---------ANAC58            ------>ZmHOX2a(2)              <-----
      --------->ANAC58         <---------RVE1(2)             <---------ARR11(3)               ------
------ZmHOX2a(1)   ------>ZmHOX2a(2)    --------->HSFB2a(2)  <---------RVE1(2)   --------->HSFB2a(2)
==========================HOX2a_HOX2a   <---------HSFB2a(2)  --------->GATA12    <---------HSFB2a(2)
------>MYB59     <---------GATA12  <---------ANAC58          --------->ARR11(3) <---------LBD16<----
taggaagggaagaaatggctgatcgaaactgtttgatttcgttcgaggatcttccttctcatttgatcttggaggtgttgacctctgggaggcttagtgc  5209500
<- Previous    Next ->

AGI:  At3g15430.1   
Description:  regulator of chromosome condensation (RCC1) family protein. similar to regulator of chromosome condensation (RCC1) family protein [Arabidopsis thaliana] (TAIR:AT3G26100.2); similar to hypothetical protein [Vitis vinifera] (GB:CAN60415.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39246.1); contains InterPro domain Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); contains InterPro domain Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091)
Range:  from: 5209027    to: 5211752    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.