Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                >>>>>>>>>>>>>>>>>LFY
                              ------->GAMYB
                             --------->MYB46(3)
                           --------->MYB52(1)
                           ----------->RAV1(1)
                          --------->AtMYB61
                         --------->MYB46(3)
                     <-----------TGA1
                     <-----------HVH21
                    --------->ANAC46
                    --------->ANAC58
                    --------->bZIP60(2)                                           <---------HSFC1(2)
            --------->YAB1--------->MYB46(3)                                      --------->HSFC1(2)
          <---------WOX13(2)------>MYB83                                         --------->ANAC58
     --------->GLK1(2)--------->TGA2(2)                                          --------->ANAC58
   --------->KAN1   --------->ANAC58              <---------KAN1           --------->At4g35610
  <---------RVE1(2)<-----------STF1  --------->KAN1                        --------->ZAT2
---------DOF2    --------->DOF5.7(1)<---------TOE1(2)  --------->YAB1      <---------At4g35610------
->ZAT6    --------->WOX13(2)------>MYB46(1)      --------->RVE1(2)         <---------ZAT2     ------
 
actttgagattccaattagaaaaacgtcaccaacagtccaatgttctaatcgaatcaaacataacctagtcaagagctagctgcaagcttctatatacct  3237700
                                                 <---------ANAC58
                                            <---------HSFB2a(2)
                                           <---------ANAC46
                                           <---------LBD16
                                          <---------LBD16
                                        <---------GLK1(1)
          ---------->DOF2          --------->O2  <---------ANAC58
      --------->GLK1(2)            --------->ANAC58   --------->YAB1
      <---------ARR11(3)           --------->ANAC58----------->GT1--------->YAB5
      --------->RVE1(2)           ------>NtERF2  <---------ANAC46 <---------ICU4
      --------->GATA12         ------>NtERF2--------->HSFB2a(2)  --------->ICU4                 ----
      <---------GATA12        --------->ANAC46  <---------ZAT2 --------->YAB1    --------->ETT(2)
------->TEIL           <-----------GT1 --------->GATA12    --------->MYB46(3)    <---------ETT(2)
--->TOE1(2)        --------->CCA1(2)   <---------GATA12  <-----------GT1--------->TOE2(3)      -----
--->TOE2(2)       <---------RVE1(2)<---------O2 <---------At4g35610     <---------MYB59       ------
 
atgaaccaaaatctaaagtcagatataaaccttgcgccacgagatttcgggagcttgtaataaccagcatgatgacctaaatcgtcgacagtagggccac  3237800
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                       --------->At4g35610                       ---
                 --------->ARR14(2)                    <---------ZAT2                            ===
                 <---------ARR11(2)                    <---------At4g35610                       <--
                 <---------ARR14(2)                    --------->ZAT2                          -----
                 --------->ARR11(2)                    --------->ZAT14                       -------
              --------->LBD16                       <---------At4g35610                      <------
            <---------LBD16                         --------->At4g35610                      -------
           <---------LBD16                          --------->LBD16                          <------
         --------->ARR14(2)                        --------->ANAC46                          <------
         --------->KAN4(2)                        <---------LBD16                            <------
         <---------ARR14(2)               --------->LBD16                                    -------
        <----------TaMYB80  <---------ANAC58 <---------TCP20                       =================
      --------->YAB1        <---------ANAC58 --------->PCF5                ----------->RAV1(1)<-----
    ----------->GT1     <---------KAN1   --------->LBD16             --------->ARR14(2)      <------
    --------->ANAC58    --------->HSFB2a(1)  --------->PCF2          <---------ARR14(2)      -------
    --------->ANAC58    <---------HSFB2a(1) <-----------HVH21        --------->RVE1(2)       <------
----->AtMYB61--------->HSFB2a(2)         <---------LBD16        ----------->GT1    <------ZmHOX2a(2)
---->MYB46(3)<---------HSFB2a(2)        <---------LBD16<---------ZAT14    ----------->HVH21  -------
>NtERF2 --------->KAN1 ------->TEIL--------->MYB46(3) ----------->RAV1(1)--------->At4g35610<-------
 
catcggcaagtatattcgggaatacgaacttccgttcaacaatccccggtccctccgcagcagtgagaggcaaatcagcgacatcgatcacattcagatc  3237900
   --------->HSFB2a(2)
   --------->LBD16
  <---------ANAC46
 <---------LBD16                  <---------LBD16
--------ZAT2                 <---------GLK1(2)
------->ZAT2             <------ZmHOX2a(2)
------->At4g35610       <---------ARR11(2)
--------At4g35610       <---------ARR14(2)
--->ZmHOX2a(1)          --------->ARR11(2)
================================HOX2a_HOX2a
---------RAV1(1)        --------->ARR14(2)
->ZmHOX2a(2)            --------->GATA12
-->ARR14(2)          <---------ANAC55(2)
---ARR11(3)          --------->ANAC55(1)
-->ARR11(3)          --------->ANAC58
---GLK1(2)           --------->ANAC55(2)
---RVE1(2)           --------->ANAC46
---GATA12--------->DAG2 <---------GATA12                    ------>ZmHOX2a(2)--------->WOX13(1)
-->AGP1 --------->DOF5.7(1) --------->At4g35610           --------->GATA12  --------->YAB5
====HOX2a_HOX2a      --------->ANAC58                     <---------GATA12 <------ZmHOX2a(2)
-ZmHOX2a(2)         <---------LBD16           --------->RAP2.6(3)          ==================HOX2a_HOX2a
---ARR14(2)        --------->MYB52(1)       <---------ARR11(2)             <---------ATHB12
-->GATA12--------->DOF5.7(1)<---------At4g35610--------->ANAC46        <-------TEIL          -------
---ARR11(2)       ----------->HVH21       --------->REM1(2) =================================HOX2a_HOX2a
-->ARR11(2)     --------->At4g35610 ------>NtERF2<------NtERF2   ---------->DOF2          --------->YAB5
--At4g35610     <---------At4g35610 --------->LBD16 --------->KAN1   --------->TOE1(2)<------ZmHOX2a(1)
 
ctgctgcgggaaaaggtttagctcacggatcagcttctccgcgcgcgtagacggcaagttcgatctctcaaaggtgcgatcattcaagaggaacgatgaa  3238000
                                                             --------------->AGL15
                                                             <---------------AGL15                 <
                                                            <-----------------AGL3              <---
                                                            ----------------->AGL2              ----
                                                            ----------------->AGL3             <----
                                                          <-----------GT1                <---------DOF5.7(1)
                --------->YAB5    <------ZmHOX2a(1)  --------->MYB52(2)                <---------DOF5.7(1)
    <---------ANAC46           <-----------RAV1(2)------------>MYB.PH3(2)          <----------------
   <---------YAB5    <----------ID1             --------->DAG2                <---------At4g35610  <
-->YAB5 ---------->DOF2    ---------->DOF2     ---------->DOF2           <----------DOF2<----------DOF2
 
gacggtatcgttgaagcgatgaagacgacgaaatgcaggagaaggctgagaaaagttagtttctccatttttggttctttcaactgtgcttctttttttt  3238100
                                                  --------->ALFIN1
                                                  ----------->HVH21
                                                 <-------MYC4                      <---------ANAC55(1)
                                                 <-------MYC2                      <---------ANAC58
                                                 ------->MYC2                      --------->ANAC55(2)
                                                 <-------PIF5                      <---------ANAC58
                                                 ------->MYC4                      <---------ANAC55(2)
                                                 ------->PIF5                     <-------TEIL
                                                 ------->MYC3                   <---------ARR11(2)
                                                 <-------MYC3                   --------->ARR14(2)
                                                --------->TGA1a         --------->ARR14(2)
                                                --------->ANAC55(2)     --------->RVE1(2)
                                                --------->ANAC46        <---------ARR11(3)
                                                --------->O2            <-----------ARR10        ---
----------DOF2                                  <---------TGA1a         --------->ARR11(3)   -------
--------GT1                               <---------KAN1<------ZmHOX2a(1)       <---------MYB52(1)
------>ID1                         <------ZmHOX2a(1) <---------ANAC46  --------->RVE1(1)  --------->LBD16
-------GT1                       --------->ALFIN1-------->ABF1         --------->CCA1(1) --------->LBD16
--------ANAC81   *TSS       <---------LBD16     <---------O2 --------->RVE1(2)  --------->ARR11(2)
---------DOF5.7(1)   ------------>CBF    <---------KAN4(2)   <-----------HVH21  <---------ARR14(2)--
 
tccttttctgagattgttgtatacaacaatttgggggaggagagaatgtacacgtggcaggaactatcacagaaatatcttccgatacgtgcccgagaaa  3238200
                                           <---------ANAC58
                                           <---------ANAC58                              ===========
                                           --------->ANAC55(2)                           --------->ANAC46
                                           ----------->GT1                               --------->ANAC58
                                        <---------MYB52(1)                               --------->ANAC58
                                   <---------ARR11(2)                             --------->ARR11(2)
                                   <---------GATA12                               <---------MYB52(1)
                                   --------->GATA12                              ==================MYC_MYB
                                   ------->TEIL            <---------TOE1(3)     <-------GAMYB
                                   --------->GLK1(2)       <---------TOE2(3)    <---------MYB46(3)
                                   <---------ARR14(2)     --------->MYB52(1) ------------>AtMYB77
                                   --------->ARR11(2)     <---------DOF5.7(2)======================MYC_MYB
                                   --------->ARR14(2)   --------->ARR11(3) <---------YAB5--------->TGA1a
                              <------MYB46(1)          --------->YAB1<------NtERF2<---------ARR11(2)
                              ----------->GT1       ---------->DOF2<---------ANAC58      <---------TGA1a
    <----------DOF2           <------MYB83 <---------ANAC55(2)<---------MYB52(1)<---------DEAR3(2)
------>ALFIN1                <---------MYB46(3)     ===============================================bZIP_DOF
--->DOF2                     --------->MYB55(2) --------->REM1(1)  <---------ANAC58 --------->MYB59
------->ALFIN1  --------->KAN1----------------------->TaNAC69(2)   <---------ANAC46 --------->MYB46(2)
 
gttggggctattttgcgaaatatgagaaatagtgggtgaatctgttacgttacaacaaagataacgtttggcgtagtaatcgacggttaggcacgcgagt  3238300
                                                                                <xxxxxxxxxxxxxxxxxxx
                                                                                <xxxxxxxxxxxxxxxxxxx
                                                                                --------->ARR14(2)
                                                                                <---------ARR14(2)
                                                                                <---------ARR11(2)
                                                                                --------->ARR11(2)
                                                                                <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                               <------NtERF2
                                                                              <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                              --------->LBD16
                                                                              <---------RAP2.6(3)
                                                                              <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                              <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                             --------->RAP2.6(2)
                                                                             <xxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                             --------->HSFB2a(2)
                                                                             --------->LBD16
                                                                 <---------AHL12(1)
                                                                 --------->AHL12(1)
                                                                <---------AHL20(3)
                                                                --------->AHL20(1)
                                                                <---------AHL12(2)
                                                                <---------AHL12(1)
                                                                --------->AHL12(1)
                                                                --------->ARR11(3)
                                                                <---------ARR11(3)
                                                    <---------AHL20(2)       <xxxxxxxxxxxxxxxxxxxxxx
                                                    --------->AHL25(1)      <---------LBD16
                                                    <---------AHL20(3)      <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                       --------->AHL20(2)       <---------AHL20(1)                 <
                                     <---------AHL12(2)         --------->AHL20(3)               ---
                                     <---------WOX13(2)         --------->AHL25(2)      --------->TOE1(2)
                                     --------->AHL12(2)         <---------AHL25(2)     <xxxxxxxxxxxx
                                     --------->WOX13(2)        <---------AHL25(2)      --------->MYB46(3)
                           --------->TCP15(1)       <---------AHL25(3)      <xxxxxxxxxxxxxxxxsmallRNA(s)
                           --------->TCP20          <---------AHL25(2)     ------>MYB46(1)<xxxxxxxxx
                           <---------PCF2           --------->AHL25(2)     --------->MYB52(1)  <----
                          <---------TCP23           --------->AHL20(2)     <xxxxxxxxxxxxxxxxsmallRNA(i)
                          <---------TCP15(2)        <---------AHL25(1)     <xxxxxxxxxxxxxxxxsmallRNA(s)
                    <---------ANAC58<---------AHL12(1)         --------->AHL12(2) <xxxxxxxxxxxxxxxxx
                    <---------ANAC58--------->AHL12(1)  ----------->GT1    ------>MYB83<xxxxxxxxxxxx
           --------->DOF5.7(1)  --------->LBD16     --------->AHL20(1)<-----------GT1 <xxxxxxxxxxxxx
         ---------->DOF2 <---------MYB46(3) ----------->GT1    --------->AHL12(3) <xxxxxxxxxxxxxxxxsmallRNA(s)
     --------->ANAC58   --------->ALFIN1<---------AHL20(2)     <---------AHL12(3)<xxxxxxxxxxxxxxxxxx
     --------->ANAC58 --------->ALFIN1 <---------AHL20(2)----------->GT1----------->RAV1(2)---------
====================bZIP_DOF--------->PCF2---------->DOF2--------->TOE2(3) <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
 
tgaatgtgaagcaaaagatggatgagtgtgggtcccagataatttaaaagtgaaataaaatgttaaaaatattcaacctgccggaatcgaaccagcgacc  3238400
                                                                  --------->YAB1
                                                                  --------->AHL20(2)
                                                                  <---------AHL20(2)
                                                                  <---------AHL25(2)
                                                                  <---------AHL20(3)
                                                       <---------DEAR3(2)
                                                       <---------MYB46(3)
                                                       <------MYB83
                                                  <---------TOE2(3)
                                                  <---------TOE1(3)<---------YAB1
                                              --------->At4g35610 --------->AHL20(3)
                                              <---------At4g35610 --------->AHL12(3)
                                             <xxxxxxxxxxxxxxxsmallRNA(fl3)
                                            <xxxxxxxxxxxxxxxxsmallRNA(s)
                                            <xxxxxxxxxxxxxxxxsmallRNA(i)                          --
                                           xxxxxxxxxxxxxxxx>smallRNA(i)                           <-
                                           <xxxxxxxxxxxxxxxxsmallRNA(i)                           <-
                                           <xxxxxxxxxxxxxxxxsmallRNA(s)                           --
                                           <xxxxxxxxxxxxxxxxxsmallRNA(se3)                        <-
                                          <xxxxxxxxxxxxxxxxxxsmallRNA(fl3)                        --
                                          <xxxxxxxxxxxxxxxxxxsmallRNA(le3)                        --
                                          <xxxxxxxxxxxxxxxxxxsmallRNA(se3)                        --
                                          <xxxxxxxxxxxxxxxxxxsmallRNA(si3)                       <--
                                          <xxxxxxxxxxxxxxxxsmallRNA(s)                           ---
                                         ----------->RAV1(2)      <---------AHL12(3)             ---
                                         <xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                       <--
                                         <xxxxxxxxxxxxxxxxxxsmallRNA(se3)                        <--
                                         <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)                      <---
                                         <xxxxxxxxxxxxxxxxxxxsmallRNA(le3)                      <---
                                         <xxxxxxxxxxxxxxxxxxxsmallRNA(se3)                      ----
                                         ------>MYB83  <------MYB46(1)                          ----
                                         ------>MYB46(1)        <---------AHL20(3)             <----
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                     ------
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                    <-----
                                        --------->MYB52(1)      --------->AHL25(1)            ------
                                        <xxxxxxxxxxxxxxxxxxxsmallRNA(se3)                     <-----
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                    ------
                                        <xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                     <-----
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                    <-----
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(s2)                     ------
                                        <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                    <-----
                                       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                    ------
                                       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                    ------
                                       <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                     ------
                                       <---------MYB111(1)      --------->AHL20(3)           <------
                                       --------->MYB46(3)    <---------RVE1(2)               -------
                                       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                   -------
                                       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                    -------
                                      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                   <------
                                      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)                    <------
                                      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                   <------
                                      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                   <------
                                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                  --------
                                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                  --------
                                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                <---------AHL20(2)
      *TSS                           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                 <---------AHL20(1)
      <----------DOF2               <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)                 --------->AHL20(2)
      --------------------->WRI1    <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                 --------->AHL20(3)
  <---------GLK1(1)                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                  --------->AHL25(2)
  --------->GLK1(1)                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                 <---------AHL20(3)
 --------->ARR11(3)                 <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                --------->AHL20(1)
 <---------ARR11(3)                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)                  <---------AHL25(3)
xsmallRNA(si3)                      <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)                     <---------AHL25(2)
xxxxsmallRNA(si3)                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                 --------->AHL25(1)
xsmallRNA(si3)                      <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)               --------->AHL25(3)
---------YAB5                       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                --------->AHL20(2)
------->DOF2                        <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)           --------->AHL20(2)
xxxxsmallRNA(i)                     <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)           <---------AHL20(1)
xxxxxxsmallRNA(le3)                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)       <-----------GT1<-----
-----MYB59       --------------->AGL15<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)     --------->ZAT6-------
xsmallRNA(se3)<-----------GT1     <----------DOF2 <---------AtMYB61<---------TOE2(3) --------->AHL20(1)
xxxxxxxsmallRNA(le3)             <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) --------->YAB1  <---------ARR11(3)
xxxxxxxsmallRNA(le3)      xxxxxxxxxxxxxxxx>smallRNA(s)<---------DEAR3(1) <---------TOE2(3)<---------AHL25(1)
xxxxxsmallRNA(le3)    --------->ZAT14<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)   <-----------GT1<-------
>DEAR3(1)    <---------KAN1  xxxxxxxxxxxxxxxxxxxx>smallRNA(si3) <---------AHL12(3)  ----------->TBP
 
taaagatttctttggaattacccattacagtcttccgctctaccaactgagctaaggtcggtttgatattaatattaagtttacactatatattaaatta  3238500
<---------YAB1
------->ATHB51
--------AHL25(3)
--------ICU4
------->YAB5
-------HAHB4
------>ATHB1
------>HAHB4
------->YAB1
-------YAB1
------>ICU4
------>AHL25(3)
-------ATHB51
-------YAB5
------WOX13(2)
------AHL12(2)
----->AHL12(2)
----->WOX13(2)
-----AHL25(3)
--->AHL25(1)
----AHL25(3)
--->AHL12(3)
----AHL20(2)
--->AHL20(1)
----AHL12(3)
----AHL25(1)
--->AHL25(3)
----AHL25(2)
--->AHL25(2)
--->AHL20(2)
--->AHL12(1)
---AHL20(2)
-->AHL25(3)              <-------MYC3
-->AHL12(3)              ------->MYC3
-->AHL20(2)             --------->TGA1a
---AHL25(1)             <---------O2
---AHL12(3)             <---------ANAC55(2)
---AHL25(2)             --------->ANAC55(2)                                      --------->YAB5
---AHL20(3)             <---------ANAC46                                        <---------YAB1
->WOX13(2)              --------->O2 --------->TOE2(3)      --------->KAN1   <---------ARR11(2)
->AHL12(2)              <---------TGA1a      <---------AHL20(2)           --------->ALFIN1         -
----AHL12(1)          <---------ALFIN1    --------------->AGL15   <---------REM1(2)               --
-->AHL20(3)          <------NtERF2   --------->TOE1(3) ----------->GT1  --------->ALFIN1         ---
--WOX13(2)           ----------->HVH21    <---------------AGL15  <---------HSFB2a(2)           -----
 
attattacaaaaacacttatgggcctcacgtgaatgtaaaccttacattttatagtgaatgtaatattctacaaggtgtgtttctgattagaaggcccaa  3238600
<- Previous    Next ->

AGI:  At3g10410.1   
Description:  SCPL49 (serine carboxypeptidase-like 49); serine carboxypeptidase. Identical to Serine carboxypeptidase-like 49 precursor (SCPL49) [Arabidopsis Thaliana] (GB:P32826;GB:Q42107;GB:Q9CAE5); similar to SCPL48 (serine carboxypeptidase-like 48), serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT3G45010.1); similar to SCPL47 (serine carboxypeptidase-like 47), serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT5G22980.1); similar to serine carboxypeptidase precursor [Matricaria chamomilla] (GB:AAD42963.2); similar to carboxypeptidase type III [Theobroma cacao] (GB:CAC86383.1); similar to putative serine carboxypeptidase precursor [Gossypium
Range:  from: 3235296    to: 3238118    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g10415.1   
Description:  pre-tRNA. tRNA-Tyr (anticodon: GTA)
Range:  from: 3238372    to: 3238407    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.