Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                           ---------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
     <---------KAN1                                                                        ---------
 ----------->GT1                                                                           <--------
--->ANAC58                                                            --------->YAB1       <--------
--->ANAC46                                                 --------->YAB1                 --------->AHL20(2)
----ANAC55(2)                                              <--------HAHB4       <-------MYC3 -------
--->ANAC58                   <---------YAB1               <---------YAB1        ------->MYC3 <------
-->AGL15                  <---------AHL20(2)              --------->ICU4      ------->TEIL--------->AHL25(3)
---AGL15           <-----------GT1           ---------->DOF2 <---------YAB1--------->AtLEC2<--------
----AGL1         <----------DOF2<----------DOF2 --------->TOE1(2)  --------->WOX13(1)   <---------GATA12
 
caaatggaataaaactataactttactattttatgctttcaaaaaactaaaagtacgagctattattagtctatcaccatgcacatgagtcgatttaatt  1225500
       <---------DOF5.7(1)
   <---------ALFIN1
  --------->ZAT14
  <---------ZAT18
------>NtERF2
--------->At4g35610
<---------At4g35610
>AHL12(3)
-AHL20(2)
>AHL25(1)                                                           ------->GAMYB
>AHL25(3)                                                          <---------MYB111(2)
-AHL25(3)                                                          <---------MYB55(2)
>AHL20(2)            --------->YAB1                                --------->MYB46(3)              -
-AHL25(1)         <---------CCA1(2)                                <---------MYB52(2)              -
-AHL12(3)       --------->TOE1(1)                          --------->HSFC1(2)                     <-
-->WOX13(2)     --------->TOE2(1)      --------->ANAC46    <---------HSFC1(2)                     --
---WOX13(2)    ------>ZmHOX2a(1)       <----------ID1     <---------GLK1(1)                    <----
-AHL25(2)--------->KAN1      <---------YAB5      <-----------GT1 ----------->RAV1(1)      <---------ARR11(2)
 
tgcagcccactcttattcctcgtatcatattagtcacttactacgacaagtttaactttggaaacctccaacaaacctatttgagactatgtggtttcga  1225600
                                                                                                   <
                                                                                                 <--
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                   --------->ARR14(2)         <-----
                                                                   --------->ARR11(2)         ------
                                                                   <---------ARR14(2)         <-----
                                                                   ------->TEIL               ------
                                                                  <---------CCA1(2)           ------
                                                            --------->AHL12(1)                ------
                                                            <---------AHL12(1)                <-----
                                                            --------->ATHB51                  ------
                                                            <---------AHL20(2)                <-----
                                                            <---------ICU4                    <-----
                                                            --------->AHL20(2)               -------
                                                            --------->ATHB12               <--------
                                           <---------TOE2(3)--------->AHL25(1)             <--------
                                           <---------TOE1(3)<---------AHL25(3)             ---------
                                           <---------AtMYB61<---------AHL25(1)             <--------
                                       <-------GAMYB       <---------YAB5                  <--------
                                    <---------At4g35610    --------->ICU4                  ---------
                               <---------ARR14(2)          --------->AHL25(3)              ---------
                               --------->ARR14(2)         <---------WOX13(2)               <--------
    <---------TOE2(3)          <---------ARR11(2)         --------->AHL12(2)               ---------
    <---------TOE1(3)         --------->At4g35610         --------->WOX13(2)               ---------
-------->YAB5            <---------bZIP60(1)            <---------AHL20(2)                 ---------
-------->ATHB12          --------->bZIP60(1)            <---------AHL25(1)                 <--------
--------YAB1      --------->DOF5.7(1) <---------MYB46(3)--------->AHL25(1)            <------ZmHOX2a(1)
------->ICU4    ---------->DOF2--------->ARR11(2)       --------->AHL20(2)    --------->YAB1 <------
-----RVE1(2)<---------ZAT6 <---------At4g35610      ----------->GT1<---------ARR11(2)----------->GT1
 
tatgattagggtttagagttaaagagtggcatcagataccgctgttgaggttgaatagtttaattatttgtatctgaactataaaaacaggaaataaaat  1225700
   --------->GATA12
   <---------GATA12
--------->AHL20(2)
---------AHL20(2)
-------AHL12(2)
------AHL12(1)
------AHL20(3)
----->AHL12(1)
----->AHL20(2)
------AHL25(2)
------AHL25(3)
----->AHL25(2)
----->AHL20(3)
------AHL20(1)
----->AHL20(1)
---->AHL25(3)
---->AHL25(1)
-----AHL25(1)
---->AHL12(3)
-----AHL25(3)
-----AHL12(3)
-----AHL12(1)
---->AHL12(1)
----AHL25(2)
--->AHL25(3)
----AHL12(1)
--->AHL20(3)                                                                                   <----
--->AHL25(2)                                                                                   -----
--->AHL20(1)                                                                                   -----
----AHL20(3)                                                                                   -----
--->AHL12(1)                                                                                  ------
----AHL20(1)                                                                                  ------
----AHL20(2)                                                                                 <------
-->AHL12(2)                                                                                  -------
-AHL25(2)                                                                                   --------
-AHL20(3)                                                                                   --------
>AHL25(2)                                                                                 <---------AHL20(3)
-AHL12(3)                                                                                 <---------AHL12(3)
-AHL20(2)                                                                                 --------->AHL20(2)
>AHL20(3)                                                                                 --------->AHL12(3)
>AHL25(3)                                                                                 --------->AHL25(2)
-AHL25(1)                         ----------->GT1             <---------YAB1              --------->AHL20(3)
>AHL25(1)                        --------->DOF5.7(1)       <---------YAB1                <---------AHL25(3)
>AHL20(2)                        --------->DAG2          <-----------GT1                 --------->YAB1
>AHL20(1)                       --------->DOF5.7(1)   ----------->GT1                   --------->AHL20(2)
-AHL25(3)          --------->DOF5.7(1)             <---------RVE1(2)                  --------->YAB1
---AHL12(2)      ---------->DOF2---------->DOF2  <---------YAB1         --------->HSFB2a(2) <-------
 
attttaaatctacatatttgtaaagaagaaatagaaaaagtcaaaaacaattctgatttgttactataatttcttccaggctccactaaaaataaaaata  1225800
     <---------DOF5.7(1)
    <----------DOF2                                      <---------ARR14(2)
   <---------DOF5.7(1)                                   --------->ARR14(2)
-----ARR11(3)                                       <-----------GT1
---->ARR11(3)                                     --------->KAN1
---->ARR14(2)                                 ----------->GT1----------->GT1
---->RVE1(2)                         --------->ARR11(3)  <---------ARR11(2)
--->CCA1(1)                          <-----------ARR10   --------->ARR11(2)
--->RVE1(1)                          --------->RVE1(2)   --------->GLK1(2)        ----------->GT1
---AHL25(2)                          <---------ARR11(3)  <---------GATA12    <------MYB83
-->AHL25(2)                         --------->CCA1(1)    ------->TEIL        <------MYB46(1)
->AHL12(3)                          --------->RVE1(1) --------->ANAC46      <---------AtMYB61  -----
->AHL20(3)                     ----------->GT1--------->LBD16--------->LBD16--------->MYB59---------
--AHL20(3)               ---------->DOF2    <---------LBD16<---------LBD16<---------MYB52(1) -------
 
tcttcttcttttttttttttttttttgtaaaagacagaaatatctaatccggtttatacgaatccggtttaaaatcggtttggttttgttacaaagataa  1225900
                                                                                             <------
                                                                                          <---------ALFIN1
                                                                                         ------>ZmHOX2a(1)
                           *TSS     --------->REM1(1)                           ------>ZmHOX2a(1)  -
           <---------ARR11(3)       <---------ALFIN1                           --------->TOE2(3)   -
        <-----------GT1   <---------ALFIN1                                  --------->GATA12 <------
---->DOF5.7(1)            --------->KAN1     --------->ANAC58               --------->ARR14(2) <----
>YAB1--------->YAB1  <---------REM1(2)       --------->ANAC58               <---------ARR14(2)<-----
-->CCA1(2) --------->ARR11(3)     ----------->RAV1(1)      <---------At5g28300 --------->TOE1(3)   -
 
gaccagattaataacatcttcgtcttcacacactctgcaacacctctcactcaaatttcattcaccatgttctctctcaaatccttaatctcctcacctt  1226000
                             -------->P --------->ANAC46
                             --------->MYB52(1)
                             ------>MYB83
                             ------>MYB46(1)
         --------->AtMYB61 --------->DEAR3(1)                                     <---------DOF5.7(2)
      --------->ANAC46     --------->MYB46(3)                        --------->ARR14(2)
   --------->RVE1(2)       <---------ALFIN1                          <---------ARR11(2)
   --------->ANAC58        <---------MYB55(2)                        --------->ARR11(2)
   --------->ANAC46        <---------MYB46(2)                   ------->TEIL<---------At5g28300  ---
   --------->ANAC58        --------->AtMYB61                  <---------SPL7(1)   <---------At5g28300
---DOF5.7(1)               <---------MYB111(2)               --------->ANAC55(2) --------->ARR14(2)
-------->ANAC58         <-----------GT1 ----------->HVH21    <---------ANAC55(2) --------->ARR11(2)
-------->ANAC58     --------->KAN4(1)  --------->MYB46(3)    --------->ANAC46    <---------ARR11(2)
---DAG2 --------->MYB46(3) <---------MYB111(1)               --------->ANAC58   <---------MYB52(1)
-------HVH21<---------ATHB12--------->MYB55(1) <---------MYB52(1)   <---------MYB52(1)       -------
-----DOF2<---------ALFIN1 --------->MYB46(3) ----------->GT1 --------->TOE1(1)  --------->DOF5.7(2)
-------->ANAC46     --------->KAN1  --------->KAN1           --------->ANAC58  <-----------HVH21 ---
 
tcacacaatccaccactcatggattattcaccaacccgattacccgacccgttaatccattaccacgtaccgtttccttcaccgttaccgcttccatgat  1226100
            --------->At4g35610
            <---------ZAT2
            --------->ZAT2
            <---------At4g35610
         ------>ZmHOX2a(1)                                               --------->DEAR3(1)
        --------->TOE2(3)                                             --------->AtMYB61
      <------ZmHOX2a(2)                                        <---------MYB52(1)
     <---------ARR11(2)                                        <---------ARR11(2)
     --------->ARR11(2)                                        --------->ARR11(2)
     <---------GATA12                                       --------->MYB46(3)
     --------->GATA12                                      -------->P <---------ALFIN1
     --------->ARR14(2)                                  <---------MYB111(1)
     <---------ARR14(2)                                  --------->MYB46(3)
     <---------ARR11(3)                                  <---------MYB55(2)
     --------->ARR14(3)                           --------->At4g35610--------->MYB46(3)
     <---------ARR14(3)                         --------->MYB46(3)   <---------MYB55(2)
     <---------GLK1(2)                        ----------->RAV1(1) <---------ETT(1)
     --------->ARR11(3)                    --------->ANAC58------>MYB46(1)                ------>MYB83
    --------->RVE1(1)                      --------->ANAC58------>MYB83  --------->DREB2C(2)
   --------->DOF5.7(1)                  --------->DEAR3(1)--------->MYB55(1)  <---------At4g35610  <
   ----------->ARR10--------->YAB5    ------>NtERF2      <---------MYB46(2)<---------MYB52(1)      <
 ---------->DOF2   <---------YAB1     --------->LBD16    <---------MYB111(2)  --------->At4g35610  <
------>ANAC58    --------->YAB1      <---------DEAR3(1)  --------->AtMYB61<-----------TGA1-------->P
-->YAB1------>ZmHOX2a(2)            --------->SPL7(1)   --------->MYB46(3)<-----------HVH21 ------->GAMYB
------>ANAC58<---------MYB52(2)     <---------LBD16--------->AGP1--------->DEAR3(2)       ------>MYB46(1)
 
acccaaaagatcctcagctaacatgattcccaaaaaccctccggcgaggcaacagctctaccaaccgttccgaccaccgtcatctcccattccaacccaa  1226200
                                                                           <---------CCA1(2)
                                                                         <---------CCA1(2)
              --------->LBD16                                          <---------DOF5.7(1)
              ------>NtERF2                                        ------->TEIL
             --------->ANAC46<---------ARR14(2)                   <---------ALFIN1
             --------->DEAR3(1)                                 --------->ANAC58
           <---------ATERF1(1)                                  --------->ANAC46
     --------->ANAC46        --------->ARR14(2)                 --------->ANAC58
   --------->KAN1           <---------GLK1(1)                   <---------ANAC55(2)
  --------->ZAT14 --------->At5g28300                           --------->ANAC55(2)
  <---------ZAT14--------->LBD16       <-----------HVH21      <---------KAN1
  <---------ZAT18----------->GT1  --------->ANAC46           --------->ARR11(2)
 <---------MYB52(1)    --------->RVE1(2)     <---------KAN1  <---------ARR11(2)                <----
---------ANAC58 --------->ATERF1(2)   <---------DEAR3(2)     --------->ARR14(2)     <----------DOF2
---------ANAC58 <---------ATERF1(2)   <---------SPL7(1)      <---------ARR14(2)    <---------DOF5.7(1)
---------ANAC46<---------LBD16   ------>ZmHOX2a(1) ----------------------->TaNAC69(2)        <------
 
ttccgttcactcgactccgccggtaaaatcgaaatcctcgccggtcgaatggctctctggttcgaatacgcacctcttatctcttctctttacaccgatg  1226300
                                                                            <---------ANAC58
                                <---------KAN1                  <---------DEAR3(2)
            ------->GAMYB     --------->ARR11(2)                <---------MYB46(3)
           --------->MYB46(3) --------->ARR14(2)               <---------DREB2C(2)
           <---------ATHB12   <---------ARR14(2)               <---------DEAR3(1)
          ------>MYB46(1) <---------LBD16                      <---------At1g77200
          ------>MYB83   --------->MYB52(1)                  <-----------HVH21
          -------->P<---------ARR11(3)              ----------->GT1         <---------ANAC58
        <---------MYB111(2) --------->LBD16      --------->ARR14(2) --------->ANAC58
      ------>ZmHOX2a(1)----------->HVH21         <---------ARR11(2) --------->ANAC58
  --------->ANAC46  --------->ARR11(3)           --------->ARR11(2)--------->ZAT18
<-----------GT1     <-----------ARR10--------->ANAC58      <---------YAB5  <-------TEIL
-----MYB46(3)      <---------KAN1    --------->ANAC58   --------->KAN1  --------->KAN1
---MYB52(1)<---------MYB55(2) <---------GLK1(2)  <---------ARR14(2)<---------ZAT18
 
gtttcactcctccaaccatcgaagaactcaccggaatctcaagcatcgaacagaaccgtttaatcgtcggtgcgcaagttcgtgactcaattcttcaatc  1226400
<- Previous    Next ->

AGI:  At3g04550.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28500.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65032.1)
Range:  from: 1225928    to: 1227442    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.