Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                      --------->ALFIN1                                       <---------MYB59
       <---------GLK1(1)                     <---------At4g35610            <---------At4g35610
<---------RVE1(2)  --------->DOF5.7(1)       --------->At4g35610      <---------YAB1
------MYB46(1) --------->ANAC58         <---------At4g35610         --------------->AGL15
------MYB83    --------->ANAC58         --------->At4g35610         <---------ZAT6<----------DOF2
------->MYB59  <---------KAN1           <---------ZAT2              <---------------AGL15
------->MYB111(1)  --------->DAG2       --------->ZAT2              ================================
---AtSPL8     ------->TEIL         --------->GLK1(2)   --------->AHL20(2)   --------->At4g35610   --
gtaggtattgaactccgaacgtaaggtgtggaatagagagtctagctgagctaaatgattttatactgctactgttattagctaacttttaacaaggagt  18050900
           <---------ATERF1(1)                                                                     -
        --------->ARR14(2)                <---------------AGL15                                  ---
        <---------PCF2                    ==========================================================
        --------->ARR11(2)              <-----------------AGL1                              <-------
        <---------ARR11(2)           <---------KAN1                                         --------
        <---------ARR14(2)          --------->ARR14(2)                                     ---------
        <---------GATA12            <---------ARR11(2)                                     <--------
        --------->GATA12            <---------ARR14(2)                                    <---------GLK1(1)
     --------->ALFIN1         ------>ZmHOX2a(1)                                           --------->GLK1(1)
   <-----------RAV1(1)      ----------->RAV1(2)<---------TOE2(3)                 <---------ANAC55(2)
   <---------ANAC46      <---------DOF5.7(1)  ---------->DOF2                   --------->SPL7(1)<--
==========================================================MADS_MADS         <---------------AtSPL3 <
------->KAN1      --------->RVE1(2) --------->ARR11(2) ----------->GT1<---------KAN1   <---------ZAT6
attatgctgtgggtctgcccctatcacctcttcctggcgaatttgccattaaggcaaatagcaaaataggcgaatagagcgagtacgggagtgatatctg  18051000
    --------->At4g35610  <---------SPL7(1)
    <---------ZAT2      <---------ETT(2)
    --------->ZAT2      <---------ANAC58
    --------->ZAT14     <---------ANAC58
    <---------ZAT14   <-----------HVH21
  --------->ANAC46 ----------->RAV1(2)
-------->ZAT14 --------->AtMYB61                                               --------->ZAT18
------>bZIP60(1) ------>MYB83                                                  <---------ZAT14
======================================================MADS_MADS                <---------ZAT18
--At4g35610    --------->MYB46(3)                                     <---------At4g35610
->At4g35610    <---------MYB111(2)                   ----------->GT1  --------->At4g35610
>ARR11(3)      <---------MYB46(2)                   ------->TEIL --------->ANAC58
-ARR11(3)  --------->SPL7(1)        ----------------->AG         --------->ANAC58          <--------
-------bZIP60(1) ------>MYB46(1)    ================================================================
---------ZAT14--------->ANAC46      ----------------->AGL1       --------->ANAC46          <--------
acttcacagcagcgtccaccaaacctgtcgtcccaaatggccaaattagtaaatgaatgtaaaaaaacaaggaagatgagagttcacaaacttactttta  18051100
              <---------HSFB2a(2)             <---------DOF5.7(1)
             <-----------------AGL1          <---------DOF5.7(1)
         <---------HSFB2a(1)                 <----------DOF2
         --------->HSFB2a(1)  ----------------->AGL1   --------->ANAC58
         <---------HSFC1(2)  <-----------------AGL1    --------->ANAC46
    <---------HSFB2a(2)  <---------DOF5.7(1)--------->TOE2(3)               --------->YAB1
    --------->HSFB2a(2) <---------DOF5.7(1) <---------DOF5.7(1)       --------->ANAC58             -
--DOF2   --------->HSFC1(2)  <-----------------AG      --------->ANAC58  ---------->DOF2           -
===============================================MADS_MADS       --------->ATHB12             <-------
-DAG2  ---------->DOF2------>NtERF2 --------->MYB59<-----------GT1    --------->ANAC58   ------>ZmHOX2a(1)
gcattatcgagaaagttcccaaagcggcccttctccattttggtaaacctttttttactagcaacaagattggaagcaaagataactcgttcctcttcgg  18051200
                                     --------->MYB46(3)                                           --
                                     --------->REM1(1)                                           <--
           >>>>>>>>>MYB98          <-----------GT1<------ZmHOX2a(1)                             <---
           <---------TOE2(3)       <---------HSFB2a(2)              --------->REM1(1)           ----
    ------->TEIL             ------->TEIL        <----------ID1     <---------ALFIN1            <---
 <---------REM1(1)        --------->ANAC55(2)   --------->MYB59     --------->ANAC46            <---
-------->At4g35610        <---------ANAC55(2) <---------MYB52(1) --------->ETT(2)               ----
-------->CCA1(2) <---------ANAC46  --------->HSFB2a(2)    --------->ARR11(3)<---------DOF5.7(1) <---
--LBD16<----------DOF2 <---------RVE1(2) ------->GAMYB---------->DOF2 --------->ANAC46          ----
agagatgaagctttaacatagtgtgtgatatgtattttctacaaccccagttaggacaaaagacattgtctacacctcgtcttatttctgagactatgcg  18051300
  <---------------AGL15 <---------MYB52(1)
  ====================================MADS_MADS               --------->TOE2(3)
 *TSS  ---------->DOF2<---------------AGL15                   --------->YAB1
---->ZmHOX2a(2)       --------->YAB5    ------------>CBF      --------->YAB5
----ZmHOX2a(2)       <-----------------AGL3                  ----------->GT1
------RVE1(2)        ----------------->AGL3              ------------>CBF
----->ARR11(2)       ----------------->AGL2             --------->ANAC58
------ARR14(2)       --------->MYB46(3)--------->ANAC58 --------->ANAC58
------GATA12        -------->P         --------->ANAC58 --------->ANAC46
----->ARR14(2) --------->YAB5          --------->ANAC46<---------ZAT18                             -
------ARR11(2)--------->ICU4         ---------->DOF2   --------->ZAT18                             <
----->GATA12  <---------ATHB12  --------->RVE1(2)<---------KAN1                             --------
atctgcaaataaaagcaatgactaaccattagtagtatctcaaagcaatagaatatagcacacaatgttaaacagagattagcattttgtatataccttg  18051400
                            ----------->HVH21                                             --------->ANAC58
                            ------->GAMYB                                                 -------->P
                            --------->DEAR3(1)               --------->YAB1               ------>MYB46(1)
                           --------->MYB46(3) <------MYB46(1)--------->YAB5               --------->ANAC58
                           <---------MYB55(2) <------MYB83 --------->ANAC58               ------>MYB83
 --------->RAP2.6(2)       --------->DEAR3(2) <---------MYB46(3)          --------->TOE2(3)<--------
-------->At4g35610      --------->MYB46(3)   --------->MYB59 <---------ICU4             --------->AtMYB61
---------At4g35610    --------->ANAC46       <---------AtMYB61         <-----------GT1 --------->MYB46(3)
->TOE1(2)            --------->ZAT18        <--------P     --------->ANAC58  ---------->DOF2--------
gaagcagccatcacaaatgaagtgtccacaaccgacgttttgacaaggttggtcagtgtaacaagcattacatttagccttatagcaaaaaccaaccaac  18051500
                                                                ----------->RAV1(2)    <---------GLK1(1)
                                                           <---------AHL25(3)          <---------KAN1
                                                          <---------AHL12(1)           --------->GLK1(1)
                                                          --------->AHL12(3)          <---------ARR11(3)
                                                          <---------AHL25(1)          <---------ARR14(2)
              <---------ICU4                              --------->AHL12(1)          <---------ARR11(2)
              --------->AHL12(1)                          --------->AHL25(3)          --------->ARR14(2)
--------->DOF5.7(1)                                       --------->AHL25(1)          --------->ARR11(3)
-------->DOF2 <---------AHL12(1)                          <---------AHL20(3)         <------ZmHOX2a(1)
>MYB46(1)    <---------AHL12(2)                           <---------AHL20(2)   --------->At4g35610
>MYB83  --------->YAB1                                    <---------AHL12(3)   --------->ZAT2
---->RAV1(1)--------->AHL12(2)                            --------->AHL20(2)   <---------At4g35610
-MYB52(2)   --------->AHL25(2)     --------->DOF5.7(1)    --------->AHL20(3)   <---------ZAT2
>MYB46(3)   --------->AHL20(3)   ---------->DOF2         --------->AHL12(2)   ------->TEIL
-MYB55(2)   <---------AHL25(2)--------->AHL20(2)         <---------AHL12(2)<---------KAN1     ------
-ATHB12<-------TEIL         <---------WOX13(2)     <---------ZAT6--------->TOE1(2) <---------TOE2(3)
->AtMYB61  <---------ICU4  --------->YAB5          ----------->GT1       <------ZmHOX2a(1)    ------
aaaaagaagattcataatttttccaagagttgattaaaaagacagagttcaatagagataaataaatacctgggcaggatgaagctgaggatatcgaacg  18051600
       <---------AtLEC2                          <------ZmHOX2a(1)
   <---------DAG2                              <---------TOE2(3)--------->SPL7(1)
   <----------DOF2                       <---------At4g35610  <---------SPL1(2)
<-----------GT1                          --------->At4g35610--------------->AtSPL3 ----------->GT1--
--->ANAC58         --------->DOF5.7(1) --------->YAB1   <---------YAB5           ---------->DOF2----
--->ANAC58  ------->TEIL              <---------YAB5  <---------GLK1(2) <---------AHL12(2)      ----
aaataacttttcatgaactcgtaagagtcagactgtaagtaatcagcagtaaggatagaatcgtccgtacaaaaaaaaaaactcaaaagtgaattcaaaa  18051700
                                    ----------->GT1                              <---------GATA12
                                   <---------TOE2(3)                             --------->GATA12
                                   <---------TOE1(3)                             --------->RVE1(2)
                     --------->DEAR3(1)                                     <------NtERF2
        <---------ZAT14          <<<<<<<<<WRKY18                      --------->At4g35610
        --------->ZAT14<---------LBD16                                <---------At4g35610
        <---------ZAT18<---------------------WRI1                    --------->ANAC58
  ----------->RAV1(1)<---------DEAR3(1)                      <---------WOX13(2)----------->ARR10
------->DOF5.7(1)    --------->ETT(2)                   --------->ANAC58 <---------At4g35610     ---
------>DOF2          <---------ETT(2)          --------->MYB52(1)    --------->ANAC58 <------ZmHOX2a(1)
----->DOF5.7(1)  <---------YAB5 --------->WRKY18(1)     --------->ANAC58 --------->At4g35610    ----
aaagacaacagtaaactctaaacgtcgacggagaagtcaaggtaaaaacataccagtgcaagtaaactaggtaagcagcggcaagatcaggactgatact  18051800
<- Previous    Next ->

AGI:  At2g43450.1   
Description:  unknown protein
Range:  from: 18050311    to: 18051302    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.