Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                   <----------DOF2    <-------TEIL
                       --------->At4g35610   <---------MYB52(2)   --------->MYB59
                     <------ZmHOX2a(1)     --------->MYB52(1)     <---------TOE1(3) <---------YAB1
               ---------->DOF2 ----------->GT1  ------->TEIL      <---------TOE2(3)>>>>>>>>>>>>>>>>>LFY
             --------->At4g35610        --------->ANAC58<---------RVE1(2)         --------->YAB1
  ---------->DOF2--------->DOF5.7(1)    --------->ANAC58--------->ARR11(3)     --------->WOX13(1)
-ZmHOX2a(1)  <---------At4g35610        --------->ANAC46<---------ARR11(3)   <<<<<<<<<GATA-1       <
gaggcgaaagtaagacagcaaagaggagcttaagaagaaaaacaagcaacgaagctttagatcattgtttaggttcatttatctatcaccattgtctatt  13452500
         --------->At4g35610                                                --------->DOF5.7(1)
         <---------At4g35610                                                ---------->DOF2
   ------>ZmHOX2a(2)                                                     --------->TOE2(2)
  <---------GLK1(1)         --------->At4g35610--------->DOF5.7(1)       --------->TOE1(2)
 <---------ARR11(3)    <---------HSFB2a(2)     --------->DAG2           --------->YAB1         -----
 --------->ARR11(3)<---------RVE1(2)           <---------TOE2(3)      --------->MYB52(1)     <------
---------YAB5 <---------WOX13(2)    --------->ATHB12                <---------MYB52(2)  --------->YAB5
tagtgatctctgagctaaatttgattttggaagatgaaatcagtggcaataaggtgagagagattagtggaactaacataagagccaacgatgtttatga  13452600
                               <---------GATA12                  <---------AHL20(2)
                               --------->ARR11(3)               --------->AHL20(2)                <-
                               <---------ARR11(3)          <---------ANAC55(2)         <---------YAB5
 <-------TEIL                  --------->RVE1(2)           --------->ANAC55(2)         <---------YAB1
--------->CCA1(2)              --------->GLK1(2)       --------->At5g28300   ------->TEIL   --------
----->DOF2      ------>ZmHOX2a(1)         --------->At4g35610  --------->AHL12(2)    --------->YAB1
---YAB1        <---------YAB1  --------->GATA12        <-----------HVH21<------ZmHOX2a(2)   --------
aagatacaatttagtattcctattgacaatcgaaaatctaaaatcatctcaatgccacggtcacataataaatagatctgtatgtttctcatcatacact  13452700
                                                  --------->ANAC46                 --------->DOF5.7(1)
                                               <---------ARR14(2)                  ---------->DOF2
                                               --------->ARR11(2)                 <---------AHL20(2)
                                               <---------ARR11(2)                <---------AHL25(3)
------>MYB46(1)                                --------->ARR14(2)                --------->AHL20(2)
------>MYB83                                   <---------GATA12                  <---------AHL20(2)
--------MYB59                             --------->RVE1(2)                    --------->WOX13(2)
->ZAT6 <---------YAB1            --------->YAB1--------->GATA12                <---------WOX13(2)
->ANAC46                     --------->YAB5    --------->RVE1(2)      --------->WOX13(2)<----------ID1
accaaatactataatttgttcaaacgtttgaatcaataacaagaacatcaaatccacaactctaaacacttcgaattgacaaaattaaaaggcaacaaag  13452800
                                                 <-----------GT1                --------------------
<---------WOX13(2)                           --------->ICU4                <---------At4g35610------
--------->WOX13(2)                         --------->YAB5                  <---------ZAT2   ------->GAMYB
-----At4g35610                             --------->KAN1                  --------->ZAT2  ---------
---->At4g35610                            <---------YAB5                   --------->At4g35610------
-->DOF2    <---------WOX13(1)         <---------YAB5                 <-----------ARR10  --------->MYB46(3)
>RAV1(1) --------->ATHB12         <---------RVE1(2)           --------->At4g35610<----------DOF2<---
ctgaattaagctcgattgatgaagaaatatggaaatggatagtgagtgattcttaccttgtaagcagttgcaattctcagcttcctttctaacaacgccg  13452900
                                                                     <---------AHL20(2)   --------->AHL12(1)
       --------->ATHB12                                              --------->AHL25(1)   <---------AHL12(1)
------>ANAC58                                                        <---------AHL25(2)   <---------AHL25(3)
------>ANAC58                                                        <---------AHL12(3)  --------->AHL20(2)
------>ANAC46                                                        --------->AHL12(2)  --------->AHL25(3)
-----ATERF1(1)                                         <---------AHL12(2)                --------->AHL12(3)
---->MYB52(1)                  <---------ANAC46      --------->AHL20(2)                  <---------AHL25(1)
->NtERF2                       <---------ANAC58      --------->AHL25(1)                  --------->AHL25(2)
-->RAP2.3(1)              <---------ANAC46           <---------AHL20(3)                  <---------AHL12(2)
->WRI1<---------YAB5     <------NtERF2 --------->ARR11(3) <---------AHL25(3)         --------->AHL20(2)
----->HVH21             <---------RAP2.6(3)          --------->AHL20(3)        <----------DOF2<-----
>DEAR3(1)              --------->DEAR3(1)            <---------AHL12(3)    <-----------GT1--------->AHL25(1)
--->DEAR3(1)<------MYB46(1)*TSS<---------ANAC58 ----------->GT1     --------->AHL12(1)  --------->AHL12(2)
---NtERF2   <------MYB83<-----------HVH21  <---------ANAC46         <---------AHL12(1)<---------YAB1
acggaattgatcatttggtttcatagccgtcgtggtgtgagagatgttgtgaagaaaaaaataaaacttgattttttttttcctttgttaaaattaatca  13453000
                    --------->ANAC46                                                   <---------AHL25(3)
                 --------->ARR11(2)                                                    <---------AHL25(1)
                 --------->ARR14(2)                                                    --------->AHL12(3)
              --------->ANAC58                                                         <---------AHL12(3)
              --------->ANAC58                                                        <---------AHL12(1)
              <---------ANAC55(2)                                         <-----------GT1  <--------
<-----------HVH21<---------ARR11(2)                            <-----------RAV1(1)    --------->AHL12(1)
--------->RVE1(2)<---------ARR14(2)                          <----------DOF2          --------->AHL25(3)
---YAB5----------------------->TaNAC69(2)                  <------NtERF2 <-----------GT1   ---------
---GT1<-----------RAV1(1)                                 <---------DEAR3(2)          --------->AHL20(2)
>WOX13(1)     --------->O2                               <---------RAP2.3(3)        --------->GATA12
------GT1     <---------ANAC46     <---------DOF5.7(1)   <---------DEAR3(1)   *TSS  <---------RVE1(2)
ccctatcacatgttgccacgtatacggctctctcaccctcttaaaactctctgaagagagtcggctctgtggttttttatcagtttagatttattttaat  13453100
----WOX13(2)                  <---------ARR11(3)
--->WOX13(2)                  --------->ARR11(3)
--AHL20(2)                    --------->RVE1(2)
->AHL20(2)                  --------->DOF5.7(1)
--YAB1                    ---------->DOF2                                           <----------DOF2
-AHL25(2)            --------->ANAC58                                              ------>ZmHOX2a(2)
>AHL25(3)            --------->ANAC58                                             <---------YAB1
>AHL12(3)          ------->GAMYB                                                 <---------ARR11(3)
-AHL20(2)         --------->MYB46(3)                        --------->KAN1       --------->ARR11(3)
>AHL20(3)        --------->ANAC58                           <---------KAN1   --------->YAB1
-AHL20(3)        --------->ANAC58                          <---------YAB1 <---------ARR11(2)
>AHL20(2)       --------->WOX13(1)                       --------->YAB5  =================HOX2a_HOX2a
-AHL25(1)      <---------WRKY38(1)          <---------DOF5.7(1)          <------ZmHOX2a(1)
>AHL25(1)      <---------WRKY12<------ZmHOX2a(2)        <---------YAB1  ----------->GT1    <--------
tactataatttaagagagtcaaccaaggcaaaagatcaatttctctctcttctctctctacgattattcagagagaggaaacatgatctttgtttctcca  13453200
                                                     <-------TEIL                 <----------DOF2
                                                    --------->ARR14(2)            <---------DAG2
                                                    <---------ARR11(2)          ------>NtERF2
                                                    --------->ALFIN1 <---------KAN1<---------DOF5.7(1)
                                                    <---------ARR14(2)        <---------RAP2.6(2)
                                            <---------DEAR3(1)       --------->GLK1(1)
                                           <---------LBD16       <---------RAP2.6(2)
                                         --------->ETT(2) <----------DOF2 --------->At4g35610   <---
                                    <----------DOF2 --------->ARR11(2)   <-----------RAV1(1)   <----
                                  <---------ZAT2   <---------SPL7(1) <---------GLK1(1)      <-------
 <---------MYB52(1)               --------->ZAT2  --------->KAN1 <---------ANAC46 <---------DOF5.7(1)
---GT1<---------ZAT14      <---------AtMYB61--------->ANAC46   --------->ARR11(2)<---------DOF5.7(1)
tccagtttgtttactggttttgtctctggtatggtccagctttgtctacggcgaggttcggctttgtttcggctatctgttgccgctttttgttttttct  13453300
   --------->AHL12(1)                                                                          <----
   <---------AHL20(2)      <---------ANAC46                                                    <----
   --------->AHL25(3)    --------->ZAT14 <---------ARR11(2)                                  <------
  --------->AHL20(2)     <---------ZAT14 <---------ARR14(2)                            ------->TEIL
  --------->AHL25(3)    <---------ZAT6 <XXXXXXXXXXXXXXXXXXXXMIR169H-N                --------->YAB5
----GAMYB    --------->GATA12<---------AtMYB61                                      <---------YAB1
-------RAV1(1)<------ZmHOX2a(2) <----------DOF2                        ----------->RAV1(1)<---------YAB1
----GT1--------->KAN1   <-----------RAV1(1)<-------TEIL   --------->ANAC46      <---------WOX13(1)
gttgaataaattatgcgatctatattagtgttgtggttttaggcgattcgtttttgcctaaacacaattctctccaacataagattgatgaatatgatgc  13453400
<- Previous    Next ->

AGI:  At2g31580.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G32320.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71745.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN62815.1); contains InterPro domain tRNAHis guanylyltransferase (InterPro:IPR007537)
Range:  from: 13447986    to: 13452928    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At2g31585.1   
Description:  other RNA
Range:  from: 13453079    to: 13453806    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.