Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   --------->RVE1(2)                        --------->YAB1
                                   <---------GATA12                      --------->YAB1
                                  <---------ALFIN1                      <---------ATHB12
                                  --------->KAN1                        --------->MYB46(3)
                                  --------->ANAC46                     ------>MYB83
                                <---------ALFIN1                       -------->P        --------->YAB1
                           --------->KAN1                              ------>MYB46(1)   --------->ANAC46
                          <---------ARR11(2)                    --------->KAN1           <---------ICU4
       ------>NtERF2      --------->ARR11(2)                    <---------AHL12(1)      <---------YAB5
      <---------ALFIN1    <---------ARR14(2)                    <---------KAN1    --------->YAB5
---->DOF2                 --------->ARR14(2)   --------->YAB5  --------->ARR14(2)--------->ICU4    <
>TOE2(3) <---------DOF5.7(1) --------->ANAC46--------->RVE1(2) <---------ARR14(2)<---------YAB5   <-
 
agaaaattgccaccttcattttagaaccatatactccacatcccatagaatcaatagacgagagcaaatattccaaccatggtaatgagtaaacatcacc  9500600
                                                                                       <------ZmHOX2a(2)
                                                                                   --------->LBD16
                                                                                  <---------LBD16
                                                                                  <---------ANAC55(2)
                                                                             --------->KAN1
                                                                             --------->YAB5
                                              <---------YAB1                <---------ATHB12
                                          <---------GLK1(1)            =======================HOX2a_HOX2a
                                      --------->HSFB2a(2)              ------>ZmHOX2a(1)
                                      <---------HSFB2a(2)        --------->YAB5   <---------ANAC46
----------DOF2 <-----------TGA1    --------->GATA12              --------->KAN1   --------->ANAC55(2)
--------DOF5.7(1)                  <---------GATA12            <---------WOX13(1)<---------LBD16   -
 
atctttagacaatgttagcgtcataagaaattcaattcgatctagaattctgattccatcaagtagattgattcctccattgattccgggatcaaaaacc  9500700
                                                            --------->LBD16
                                                            --------->ANAC46
                                                           --------->DEAR3(1)
                                                           <---------ATERF1(2)
                                                           --------->DREB2C(2)
                                                   <---------GLK1(1)
                                                   --------->GLK1(1)
                                                   --------->KAN1
                                                   --------->HSFB2a(1)
                                                  <---------ARR14(2)             <---------ARR11(2)
                                   <---------LBD16--------->ARR14(2)         <---------LBD16
                            <-------TEIL          --------->ARR11(2)        --------->MYB52(1)
                        --------------->AtSPL8   <------NtERF2             <---------ALFIN1
                        <---------------AtSPL8  --------->LBD16        --------->ANAC58
                        <---------------AtSPL3 --------->RAP2.6(2)     --------->ANAC58
                       --------->DOF5.7(1)    <---------LBD16    <---------ATHB12--------->ARR11(2)
                  <---------MYB46(3) ----------->GT1       --------->ATERF1(2) --------->LBD16
-------->REM1(2)<---------MYB52(1)<---------At5g28300     <---------LBD16 --------->ZAT18
 
catgtagaaactccataccattgggtaagagtacattcaccggttaatagccggaaattccaccggcaatgaacaagcacaccggaaacaaactttctat  9500800
                                                       --------->ALFIN1
                             <---------YAB1          <---------KAN1
                            --------->TOE2(3)        --------->ALFIN1                         ------
                           <---------ICU4           <---------ARR14(2)               <---------GATA12
                       <------ZmHOX2a(2)            <---------GATA12                 --------->GATA12
                      <---------GATA12          <---------At4g35610                 --------->GLK1(1)
                      <---------ARR11(2)       --------->MYB52(1)            <---------YAB5  -------
                      --------->GATA12       <------NtERF2  <---------KAN1 --------->YAB1    <------
             <---------ARR11(2)             --------->RAP2.6(2)          <---------AHL20(3)  <------
             --------->ARR11(2)--------->AHL20(3)   --------->ARR11(2)   --------->AHL20(3)  -------
  --------->DOF5.7(1) --------->ARR11(2)  --------->At4g35610        --------->YAB1 <---------GLK1(1)
---------->DOF2       --------->RVE1(2)   <---------At4g35610--------->YAB5--------->WOX13(1)<------
 
gaagaaagacaacttggttccatcggatcaacattataagatgggagcggcaacggatgtgggatgactctatcatattaatcactgaaatccaaaaaaa  9500900
                                                                                  --------->DEAR3(2)
                                                                                  --------->MYB46(3)
                                                                           --------->GLK1(1)
                                                                           <---------GLK1(1)
                                                                        --------->LBD16 <---------ANAC46
         --------->AtMYB61                                              ------>ZmHOX2a(1)
         <---------MYB59                                            <---------ARR14(2)  <---------ANAC58
       ------->TEIL                                                 --------->ARR14(2)  <---------ANAC58
--->DOF5.7(1)       <---------KAN1----------->HVH21                <---------At4g35610<---------ANAC46
-->AHL25(2)     --------->ANAC58<---------ANAC58                  <---------DEAR3(2) <---------MYB52(1)
---AHL25(2)     --------->ANAC58<---------ANAC58               <-----------HVH21<---------ALFIN1  --
---AHL25(1)------>MYB83  <------NtERF2                         ------------>AtMYB77--------->DEAR3(1)
-->AHL20(2)--------->ANAC46   --------->DOF5.7(1)       ----------->HVH21  --------->KAN1         --
---AHL12(3)------>MYB46(1)  ---------->DOF2    <---------RVE1(2)  --------->MYB52(2)<-----------HVH21
 
atgagaaatgaaccaaaccacgaatggccccaaaagcgtgaccaaagtctgatttggaattgacagggtcagttcctgaaatcccaccgtcgcgtagagg  9501000
                                    --------->WOX13(2)          --------->WOX13(2)
                                    <---------WOX13(2)          <---------WOX13(2)
                                   <---------ICU4              --------->ATHB51
                                  --------->AHL25(3)           --------->YAB1
                                  <---------AHL20(2)           --------->ATHB12
                                  --------->AHL20(2)           <------------ATHB5
                                  <---------AHL25(1)           <--------HAHB4
                                  --------->AHL25(1)           <---------ICU4
                                  <---------AHL12(1)           --------->YAB5
                                  --------->AHL12(1)           <--------ATHB1
                                 <---------YAB1               --------->AHL20(2)
                                 <---------AHL12(2)           --------->AHL25(3)
       <------MYB83             --------->AHL12(2)            --------->ICU4
       <------MYB46(1)         --------->ATHB51               <---------ATHB12
      <---------TOE2(2)        <--------HAHB4                 <---------ATHB51
      <---------TOE1(2)        <---------ICU4          ----------->GT1
   --------->ANAC55(2)        <---------YAB1          <---------------AtSPL8
   <---------ANAC55(2)        --------->ICU4          --------------->AtSPL8
   <---------ANAC46   <---------GATA12               <------------CBF
   <---------ANAC58   --------->GATA12             <---------AHL20(2)                             --
   <---------ANAC58   <---------RVE1(2)            <---------AHL25(1)               --------------->AGL15
   <---------ANAC55(1)<---------GLK1(2)            --------->AHL20(3)               <---------------AGL15
  --------->MYB59     --------->ARR14(2)          --------->AHL20(2)        <---------AHL25(3)  ----
------->ANAC58        <---------ARR14(2)   ---------->DOF2------------>CBF  --------->AHL20(2)  ----
------->ANAC58  --------->GLK1(2)--------->AHL12(2)<---------AHL20(3)  <------ZmHOX2a(1) -----------
 
caagttacgtaggtttgacaatctagatttgccattattaattactgaaagtataaaattgtacaataattagaggaaataaaacaactaaatggagaaa  9501100
                                            <------NtERF2
                                           ------>NtERF2
                                           <---------ATERF1(1)
                                         --------->ORA47(2)
                                     ------>NtERF2
                       --------->SPL7(1)<---------RAP2.3(1)
                      <---------ATERF1(1)<------NtERF2
                      ------>NtERF2  <---------ATERF1(1)
                     --------->DEAR3(1) ------>NtERF2
                     <---------DEAR3(1)--------->ANAC46
                    --------->ATERF1(1)--------->DEAR3(1)
             --------->LBD16        <---------DEAR3(1)
           <------NtERF2<---------DEAR3(1)<---------ATERF1(2)
           --------->ATERF1(1)      ----------->HVH21
           <---------LBD16<------NtERF2<---------DEAR3(1)
          ------>NtERF2--------->ATERF1(1)<---------DEAR3(1)
         --------->DEAR3(1)        --------->ATERF1(1)
         <---------DEAR3(1)  <------NtERF2--------->DEAR3(1)
         --------->ANAC46 --------->ATERF1(1)  <------NtERF2
        --------->ATERF1(1)<---------ANAC46--------->ORA47(1)
        <------NtERF2----------->HVH21--------->SPL7(1)
        --------->SPL7(1)------>NtERF2<------NtERF2
       ------>NtERF2--------->DEAR3(2)--------->ATERF1(1)                                  <--------
       <---------ATERF1(1)<---------LBD16--------->ATERF1(1)                               ---------
      ----------->HVH21<------NtERF2--------->DEAR3(1)                                 <---------YAB1
      --------->DEAR3(1)--------->ANAC46<---------ATERF1(1)                          --------->YAB1
---------->CBF<------NtERF2--------->DEAR3(1) --------->RAP2.6(2)                    ----------->GT1
----->ANAC58--------->DEAR3(1)     --------->DEAR3(2)  <---------ANAC46    ------>ZmHOX2a(1)
----->ANAC58<---------ANAC46--------->LBD16<---------SPL7(1)   --------->DOF5.7(1) <------------CBF
>GT1  <---------DEAR3(1)--------->DEAR3(1)--------->ATERF1(2)---------->DOF2  <------------CBF     <
 
cgacaatggccgacgccggagaggccgacgccggagaggccgacgccggccgaaaatggtggagaaaagaaggttttcctgtattgtattgtaataaaac  9501200
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL25(3)
                                                                                  --------->AHL25(2)
                                                                                  --------->AHL25(3)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL12(3)
                                                                                  <---------AHL12(3)
                                                                                  <---------AHL25(1)
                                                                                  --------->AHL25(1)
                                                                                 <---------AHL25(2)
                                                                                 --------->AHL25(3)
                                                                                 --------->AHL12(3)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL20(1)
                                                                                 --------->AHL20(3)
                                                                                 <---------AHL20(3)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL25(1)
                                                                               <---------WOX13(2)
                                                                               <---------AHL12(2)
                                                                               --------->WOX13(2)
                                                                              --------->AHL20(3)
                                                                              <---------AHL20(2)
                                                                              <---------AHL25(3)
                                                                              --------->AHL20(2)
                                                                              <---------AHL20(3)
                                                                             <---------AHL12(1)
                                                                             <---------AHL25(1)
                                                                             --------->AHL25(1)
                                                                             <---------AHL20(2)
                                                                             --------->AHL20(2)
                                                                        --------->AHL12(3)
                                                                        --------->AHL20(3)
                                                                        <---------AHL20(2)
                                                                        <---------AHL12(3)
                                                                      --------->AHL12(3)
                                                                      --------->AHL25(2)
                                                                      <---------AHL12(3)
                                                                      <---------AHL12(2)
                                                                     <---------AHL20(1)
                                                                     --------->AHL12(1)
                                                                     <---------AHL12(1)
                                                                     --------->AHL20(3)
                                       <-------MYC2                  --------->AHL20(1)
                                       ------->MYC3                  <---------AHL20(3)
                                       <-------MYC3                  <---------AHL25(3)
                                       ------->MYC2                  <---------AHL25(2)
                                       <-------PIF5                 --------->AHL12(1)
       --------->YAB1                  ------->MYC4               --------->AHL12(2)
    <------------CBF                   <-------MYC4           --------->WOX13(2) --------->AHL25(1)
   <---------ICU4                      ------->PIF5           <---------WOX13(2) --------->AHL20(2)
   --------->ATHB12                   --------->TGA1a   <---------ARR11(3)   --------->AHL25(3)
  --------->ICU4                      <---------TGA1a   --------->AHL20(1)   --------->AHL12(1) ----
  <---------YAB1                      <---------O2      --------->RVE1(2)<---------YAB1         <---
  <---------YAB5                      --------->O2      --------->ARR11(3) <---------WOX13(2)  -----
<---------ICU4                      <---------ALFIN1    <-----------ARR10<---------AHL20(2)    <----
--------->YAB1                      <------------OsbHLH66 --------->TOE2(3)--------->WOX13(2)  <----
-AHL20(2)                        --------->PCF2        --------->RVE1(1)<---------AHL20(3)   <------
>AHL20(2) --------->YAB1         --------->ZAT18       --------->CCA1(1)<---------AHL25(2) ---------
---------ATHB12                  <---------ZAT18   --------->MYB46(3)--------->AHL25(2) <-----------GT1
 
aaatcatcattgatcatattagaggcgaaacacttgtgcccacgtgtgaaatcaacaaatatcttagtttaatatttttattaatttaattctactatat  9501300
          <---------AHL20(2)
      --------->AHL12(3)
      --------->AHL25(1)
      --------->AHL12(2)
      <---------AHL12(3)
     <---------AHL20(1)
     --------->AHL25(3)
     --------->AHL25(2)
     <---------AHL25(2)
     --------->AHL20(1)
     --------->ARR11(3)        --------->YAB1
     <---------ARR11(3)       <---------YAB5
    --------->CCA1(2)         <---------YAB1
   --------->ARR11(3)       <-----------GT1
   <---------RVE1(2)      <---------AHL25(1)                                     --------->AHL20(2)
----->AHL20(1)            --------->AHL12(3)                          <---------WOX13(2)
------AHL20(1)            <---------AHL20(2)                          --------->WOX13(2) --------->KAN1
---->AHL12(3)             <---------AHL20(3)                        ------>ZmHOX2a(1)   <---------YAB5
-----AHL12(3)      --------->YAB5                                 --------->YAB1 --------->AHL20(3)
-----AHL20(2)      <-----------GT1                              <---------ARR14(2)    ----------->GT1
-----TBP--------->AHL12(2)--------->AHL20(3)                    --------->GLK1(2)--------->AHL25(1)
------>AGL15      <---------KAN1       --------->ZAT6  --------->GLK1(2)         <---------AHL20(3)
 
atattagatatattttatagaataactatttttatcatactaacaccaattgctaaacaatctgaagaatcctaattttgccaaaaaaatagttattcca  9501400
                                                                                                   <
                                                                                                   -
                                                                                                ----
                                                                                                <---
                                                                                               <----
                                                                                              ------
                                                         <---------AHL20(2)                   ------
                                                         <---------AHL25(3)                   <-----
                                                         <---------AHL25(1)                   ------
                                                        --------->AHL25(1)                    <-----
                                                        <---------AHL20(3)                    <-----
                                                        <---------AHL20(2)                    ------
                                                        --------->AHL20(1)                    <-----
                                                        <---------AHL25(1)                    ------
                                                        --------->AHL25(2)                    ------
                                                        <---------AHL25(3)                    <-----
                                                        --------->AHL25(3)                  <-------
                                                        <---------AHL25(2)         <----------DOF2 -
                                                        --------->AHL20(2)        <---------ANAC58--
                                                       <---------AHL12(2)         <---------ANAC58--
                     --------->MYB52(1)                --------->AHL12(2)       <-----------GT1<----
                   <---------MYB52(2)        <---------AHL20(2)   --------->AHL20(2)    ------>ZmHOX2a(1)
                 --------->ZAT6           --------->AHL20(1)      <---------AHL20(2)   --------->TOE2(3)
    --------->WOX13(2)                    <---------AHL20(1)   ------->TEIL  <---------ICU4 --------
 
aaattcaaatttagttcttaccactaactgtgaacaattgtttaatatataaactaaaatttaatgcatttaaactacaaaaattactttcctaaaatta  9501500
<- Previous    Next ->

AGI:  At2g22340.1   
Description:  unknown protein
Range:  from: 9499959    to: 9501035    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.