Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                      <---------ANAC58                        <-----------STF1
                                     <-------TEIL                            <---------DOF5.7(2)
                                  --------->KAN1                            --------->WRKY12
                              --------->At4g35610         ----------->GT1   ----------->HVH21
                              --------->LBD16        --------->At4g35610   <---------WOX13(1) <-----
                         --------->KAN1<---------------AtSPL8     ----------------------->TaNAC69(2)
--------DOF5.7(1)        <---------GLK1(1)           <---------At4g35610   <--------P   <---------ANAC58
---------DOF2           <---------YAB5<---------ANAC58  =================================bZIP_DOF
--------DAG2          --------->ETT(2)<---------ANAC46  ---------->DOF2    ==============MYC_MYB
actttattgtttcaaaaactcattgtagacatccgctaaattcgtgtacaaaactcagcaaaagttaaatgctgtctggttgacgtcactgtcttgtgat  7710500
                        --------->HSFC1(2)            --------->RVE1(2)
                        --------->HSFB2a(1)           --------->ARR11(3)
                  --------->RVE1(2)      <-----------GT1                                  <---------AHL20(2)
                  --------->GATA12   --------->YAB5   --------->GLK1(2)                   --------->AHL20(2)
                  <---------GATA12  <---------YAB1    <---------ARR11(3)                <---------WOX13(2)
->GT1     <---------KAN1<---------HSFC1(2)<---------TOE2(3)        <---------AtLEC2     --------->WOX13(2)
----RVE1(2)      XXXXXXXXXXXXXXXXXXXX>MIR846          <---------GATA12       --------->ANAC46   ----
atatgaagttagaatacttcaaatcgaagttcctaaatgatgtttaacatttttaaaaatctagtattttgcattgttacacgagaaacttatttaaaat  7710600
                                 --------->AHL25(1)       <----------DOF2    <---------YAB1
                                 <---------AHL25(1)    <-----------GT1  --------->AHL12(1)
                                <---------AHL20(1)     <---------AHL20(2) <---------YAB1
                                <---------AHL20(2)  --------->AHL20(3)  <---------AHL12(1)
                                --------->AHL20(2)  <---------AHL20(1)  --------->KAN1
                                --------->AHL25(1)  --------->ARR11(3)  -------->HAHB4
                                --------->AHL25(2)  --------->AHL20(1)  <---------AHL25(3)
                                <---------AHL12(1)  <---------AHL20(3)  <---------AHL20(2)
                                --------->AHL25(3)  --------->AHL12(1)  <---------ICU4
                   <---------AHL25(3)               <---------AHL12(1) <---------ATHB51
                   <---------AHL20(2)               --------->AHL25(2) --------->ICU4
                  <---------AHL20(3)                <---------ARR11(3) <---------YAB5
                  <---------AHL12(3)                <---------AHL25(3) <---------YAB1
                  --------->AHL25(1)                <---------AHL25(2)--------->AHL12(2)     -------
                  --------->AHL20(2)                <---------ICU4----------->GT1            -------
                  --------->AHL12(3)          ----------->GT1  ---------->DOF2               -------
                  --------->AHL20(3)      <---------YAB1  ==========================================
                  --------->AHL25(2)   <---------AHL20(2) --------------->AGL15 <---------ATHB12
             <---------RAP2.6(3)<---------AHL25(2) --------->AHL12(2) <---------WOX13(2)  --------->ZAT18
   <---------YAB1--------->AHL12(2)    --------->AHL20(2) <---------------AGL15 <---------YAB5
----->YAB1  --------->RAP2.6(2) --------->AHL12(1) --------->ICU4<---------TOE2(3)   ---------->DOF2
catactattcttaagccgaaattttatatgatcaattttttttttaatattgtaatattttctttataaaggtaattattctaatcgtttaagcacacga  7710700
                           <------ZmHOX2a(2)           ---------->DOF2
                          --------->ARR14(2)      ==================================================
                          <---------GATA12        <---------------AGL15
                          --------->ARR11(3)      --------------->AGL15                    ---------
                          <---------ARR11(3)      <---------DAG2                           ---------
                          <-----------ARR10       <----------DOF2                          ---------
                          --------->GATA12 <---------DOF5.7(1)   --------->ARR11(3)   <---------AHL25(1)
        --------->ZAT6    <---------ARR14(2)   <-----------GT1   --------->AHL20(1)   --------->AHL20(2)
  --------->YAB5         <------ZmHOX2a(1)<----------DOF2--------->ANAC58             --------->AHL25(1)
-->ANAC58              --------->MYB59    <---------DAG2 --------->ANAC58           <---------WOX13(2)
-->ANAC58           <---------WOX13(2)    <---------DOF5.7(1) ----------->GT1       --------->WOX13(2)
-->ANAC46           --------->WOX13(2)   <---------DOF5.7(1)---------->DOF2       --------->AHL20(2)
==================================================================MADS_MADS      <---------ATHB12
ctagacgattagcactaatacaaaattaggatcttattcttaacccttttttacttttcaaagcaaagtatattgcaaattgcaatgaattaaacctaag  7710800
                                          <---------AHL12(1)                                       <
                                          --------->AHL12(1)                                      <-
                                          <---------AHL20(2)                                     <--
                                          <---------AHL12(3)                                     ---
                                          <---------AHL25(3)                                     ---
                                          <---------AHL25(1)                              <---------
                                          --------->AHL25(1)                              ==========
                                          --------->AHL12(3)                           --------->ARR11(3)
                                          <---------AHL25(2)                         --------->HSFC1(2)
                       ---------->DOF2    --------->AHL25(2)                         <---------HSFC1(2)
       ------>ZmHOX2a(1) ----------->GT1 --------->AHL25(3)                          --------->HSFB2a(1)
       <---------------AGL15            --------->AHL12(2)                         ---------->DOF2--
      <-----------------AGL3            --------->WOX13(2)                     =====================
--------->MYB52(1)   --------->TOE2(3)  <---------WOX13(2)              --------->YAB1 <---------ARR11(3)
<-----------GT1      <---------MYB59  --------->AHL25(1)             ------>MYB46(1) <---------HSFB2a(1)
=======================MADS_MADS      --------->AHL20(2)             ------>MYB83  =================
>TOE2(3)    <---------WOX13(1)        <---------AHL20(2)        <-----------GT1---------->DOF2   <--
>TOE2(2)   --------->WOX13(2)         <---------YAB1         <----------DOF2  --------->AHL20(2)<---
>TOE1(2)   <---------WOX13(2) --------->DOF5.7(1)            =======================================
aaataacgtcctctaattggtttacctaaagaaaaaatgttttaattaatttaaaacaaaatagcttttaccaaatgaaaataaaagaaagttctttgcc  7710900
------>O2                                                                      <-----------TGA1
-DOF2  <---------CCA1(2)                                                       <-----------HVH21
=======bZIP_DOF                                                          <---------YAB1
------->LBD16                                                          --------->KAN1
=======bZIP_DOF                                                     <---------ZAT6
=======bZIP_DOF                      *TSS                         <---------ANAC58
-------TGA1a               ----------->HVH21        --------->DAG2<---------ANAC58        ----------
------LBD16 <---------DOF5.7(1) <---------O2       ---------->DOF2<---------ANAC46   --------->ATHB12
=======bZIP_DOF      <---------CCA1(2)          <----------ID1 <----------DOF2--------->ANAC46
ccgtgagctcatctctcttctcttctatctctgactcgtggttttctgaaaacgaaaagtttgaaactttcgtgttattcttcgtcactgattgtgacac  7711000
                                        --------->KAN1           --------->ANAC58
                        ------>ZmHOX2a(1)<---------GLK1(2)       --------->ANAC46
                     <---------YAB1 ----------->RAV1(1)          --------->ANAC58 ---------->DOF2
                    <-----------GT1--------->REM1(1)   --------->ANAC58    --------->AHL20(2) ------
                 <---------GLK1(2)------>MYB46(1)      --------->ANAC58  <----------DOF2     <------
 ---------->DOF2--------->YAB5    ------>MYB83       ---------->DOF2  --------->ANAC58       -------
->HVH21      ---------->DOF2      -------->P       --------->AtLEC2   --------->ANAC58       <------
atataaaagaacccctaaaagattatccttcttcacctacaacaaattctggccatgaaagcaaactcaccccaagctttaaatgcaaagtagcgaaaca  7711100
                                        --------->RVE1(2)                                         --
                                       --------->KAN1                                             --
                                 --------->ANAC58                                        --------->At5g28300
--->KAN1                         --------->ANAC58                                       ----------->GT1
---HSFC1(2)                --------->MYB46(3)             <-----------GT1            <---------ALFIN1
-->HSFC1(2)           <---------DOF5.7(1)       <----------DOF2                     --------->MYB46(3)
---YAB5    ------>ZmHOX2a(1)--------->YAB5     <---------DOF5.7(1)          <---------At4g35610   <-
tcccatcccatctcctccctctctctcttaaccactaagcaaaaatcccatctttctatataaacctctctcccaactctgctacttcccaccgtaaatc  7711200
                               --------->ICU4         --------->ARR14(2)
             --------->YAB1 <---------YAB5            --------->GATA12 <----------DOF2
<---------LBD16<---------KAN1  <---------YAB5         <---------ARR14(2)
--------ARR14(2)           <-----------TGA1           <---------GATA12<---------DOF5.7(1)          <
------->ARR11(2)          --------->O2             ----------------->AGL1  <-----------HVH21    <---
------->ARR14(2)          --------->bZIP60(2)   <---------GATA12<-----------GT1         ------------
--------ARR11(2)         <------NtERF2         --------->KAN1 <---------DOF5.7(1)   ------>ZmHOX2a(1)
gtttctgggttcttaagaataacatggcctcgtcatcatcatcatcttatagattccaatctgggtcttaccctctttcgtcaagtccttctcttgggaa  7711300
                                                <---------ANAC58  --------->ARR11(3)
                                                <---------ANAC58  <---------ARR11(3)
                                         <---------------AGL15    --------->GATA12
                                         <----------DOF2 --------->RVE1(2)
      --------->ANAC58                   --------------->AGL15    <---------GATA12
      --------->ANAC58                  <-----------------AGL2 --------->LBD16
   <---------SPL7(1)          <---------ANAC58 <---------------AtSPL8  <---------WRKY18(1)
---------ANAC46        <---------YAB5  --------->At4g35610     ------>NtERF2
------KAN1  ---------->DOF2   <---------ANAC58<---------ANAC46--------->ANAC46
--------->WRI1--------->DOF5.7(1)      <---------At4g35610   <---------LBD16   <<<<<<<<<TBF1
tttcgtcgaacgcattaaagacgcttgtcatttccttgtctctgctgttttgggtaccattatctccgcgatcttgaccttcttcttcgcactaggtttg  7711400
<- Previous    Next ->

AGI:  At2g17730.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. Identical to RING-H2 finger protein ATL2B (ATL2B) [Arabidopsis Thaliana] (GB:Q8GT74;GB:Q8GWW3); similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:AT4G35840.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42935.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 7710938    to: 7712832    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.