Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         --------->MYB59                                                                         <--
     <---------MYB46(3)                                                                          <--
--------->DOF5.7(1)                                       --------->WOX13(2)          <---------AHL12(2)
-------->MYB52(1)                                  <---------WOX13(2)                <---------AHL25(3)
--------ARR14(2)                               --------->YAB1             <----------DOF2    <xxxxxx
--------ARR11(2)                          <---------HSFB2a(2) <---------At5g28300    --------->AHL20(2)
------->ARR11(2)                          --------->HSFB2a(2) <-----------GT1   --------->AHL20(2)
------->ARR14(2)                    --------->YAB5<---------ICU4   --------->KAN1  <---------WOX13(2)
----ZmHOX2a(1)                   --------->At4g35610 <-----------GT1  <---------YAB5--------->AHL20(2)
-ZmHOX2a(1)                 >>>>>>>>>TBF1 ------>ZmHOX2a(1)  <-----------GT1  ----------->GT1-------
ggaaacggcgattaggtttttttagggggaagaagaagatgactcctcgatgaaaattacaaatttacccctattcgttttaagtaaataaaaaactaat  6942600
                                                                 --------->AHL12(3)       <---------
                                                                 <---------AHL12(3)     --------->WOX13(2)
                           <---------ZAT14                       --------->AHL25(1)     <---------WOX13(2)
                           --------->ZAT14                       --------->AHL20(2)    <---------ICU4
                          ----------->HVH21                      <---------AHL25(3)   --------->AHL12(1)
                      --------->ZAT2                             --------->AHL25(2)   <---------AHL20(2)
                      ----------->RAV1(2)              --------->ANAC46      <---------AHL20(3)
         <-----------------AGL1                       --------->ZAT14       --------->AHL25(1)
      <---------YAB5  <---------ZAT2                  <---------ZAT14       --------->AHL20(2)
  --------->LBD16     --------->O2                  --------->ANAC46        --------->AHL25(3)   ---
--------->SPL7(1)     <---------TGA1a             --------->ZAT6 --------->AHL25(3)   --------->AHL25(1)
<---------LBD16       <---------O2                --------->YAB5 <---------AHL25(1)   --------->AHL20(2)
-------ANAC58         --------->TGA1a --------->ARR11(3)         <---------AHL25(2)   <---------AHL12(1)
-------ANAC58       <---------ALFIN1  --------->ARR14(2)  ----------->RAV1(1)--------->AHL20(3)  <--
xxxxxxxxxxxxsmallRNA(le3)<-----------HVH21------>ZmHOX2a(1)      <---------AHL20(2)   --------->AHL25(3)
-->KAN1--------->KAN1------>NtERF2    <---------ARR14(2) --------->ANAC46   <---------AHL20(2) -----
tcgtgcggagttattcgaactggccacctgtgaagtcttaaaatcctctagtaccactacacaacaaataaaatttgtattaatttcgattaattacatt  6942700
                                                                     --------->YAB5  --------->ANAC55(2)
                                                                     <---------ICU4 --------------->AtSPL3
                                                   <---------YAB1   <---------AHL20(3)
                                                --------->AHL20(2)  <---------AHL12(3)
                                                --------->AHL25(1)  --------->AHL20(3)           ---
               --------->ARR11(3)               <---------AHL20(3)  <---------AHL20(2)     ---------
               --------->GATA12                 --------->AHL20(3)  --------->AHL12(3)  <---------ARR14(2)
         --------->YAB5                         <---------AHL20(2)  <---------YAB1  --------------->AtSPL8
       <---------TOE2(3)                        <---------AHL25(1)  --------->AHL20(2)  --------->ARR11(2)
   --------->TOE1(3)                            --------->AHL25(2)  <---------AHL25(1)  ------->TEIL
   --------->TOE2(3)                            --------->AHL25(3)  <---------AHL12(1)  --------->ARR14(2)
<-----------GT1<---------GLK1(2)                <---------AHL25(2)  --------->AHL12(1)  <---------ARR11(2)
--GT1 --------->MYB52(1)                   <---------YAB1           --------->AHL25(1)  --------->MYB52(1)
-------->TBP   <---------RVE1(2)           <---------YAB5          --------->AHL25(3)--------->ANAC46
-------AHL12(2)<---------GATA12         <---------AHL20(2)     ------->TEIL--------->YAB5  <xxxxxxxx
---->AHL20(2)----------->ARR10    --------->WOX13(2)     <---------RVE1(2)<---------YAB1-------->P--
atataaccctaacgtttagattttgaaattagttttcaactaatttatgattttatttttgatatgtatatataattacgattcaaacacgtacccgctt  6942800
  <---------AHL25(2)                                        <------MYB46(1)
  --------->AHL25(3)                                        <------MYB83
  --------->AHL12(1)                                       <---------AtMYB61
  --------->AHL12(3)    --------->ANAC46                  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
  <---------AHL12(3)  <-----------GT1                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)      <--
  <---------AHL12(1)<---------DOF5.7(1)          --------->YAB1  --------->AHL12(2)    --------->ANAC55(2)
 --------->AHL12(2)<---------DAG2    --------->ARR11(2)   <--------P                   <---------ANAC55(2)
------>TOE2(3)     <---------DOF5.7(1)   <---------At4g35610<---------MYB46(3)    --------->YAB5 <--
>ANAC46     --------->KAN1           <---------ARR11(2) --------->ALFIN1       --------->WOX13(2)---
xxxxxxxxxxxxxxsmallRNA(le3)xxxxxxxxxxxxxxxx>smallRNA(s) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   <---
---->ZmHOX2a(1)    <----------DOF2xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<-----------RAV1(1) ------->TEIL
cctaaattttttcaaaaactcgcttttacgcttccaaacgcttccgcttctatcagagagtgttggtttatttatgtggtttagttgattatgtatttcg  6942900
<---------YAB1                                                     --------->AHL25(3)
-------ARR11(2)           ----------->TBP                          <---------AHL20(1)  <------------MYB.PH3(2)
-------MYB52(1)    --------->YAB1          <-------TEIL      --------->YAB1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
------>ARR11(2)   <---------YAB5 <---------------AtSPL8    <---------WOX13(2) --------->WOX13(1)   <
----GAMYB     --------->ZAT14 <---------AHL20(2) <-----------GT1   <---------ARR11(3)  --------->MYB46(3)
gttatgttaacaggttgtatagtcatagtatatatacttgtacaaatacattttacagagttaatgagaaaatattttcatcaatctctaacaaactctc  6943000
               <XXXXXXXXXXXXXXXXXXXXXMIR845B              <---------ARR11(2)
          ----------->GT1                                 --------->ARR14(2)
          --------->YAB1                                  <---------AGP1                   <--------
         <---------ATHB12                                 <---------ARR14(2)            ------>ZmHOX2a(2)
     ------------>CBF                                     <---------GATA12             <------ZmHOX2a(2)
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(s2)                  <---------HSFB2a(2)            --------->ARR14(2)
---------CCA1(2)    *TSS            ------->GAMYB      --------->HSFB2a(2)     <---------At4g35610<x
tcatctctctcaatcgtaatatggtatcagagccatcaacgctcaaactccattgtttctcgatctgatttcttcattttcaagctcacgatcgtcttct  6943100
                       ----------->HVH21 <---------bZIP60(2)
                     --------->YAB1      <---------ANAC58
                    <---------ATHB12     <---------O2
               <<<<<<<<<<<<<<<<<LFY      <---------bZIP60(1)
               --------->CCA1(2)         <---------ANAC58                                        xxx
               <------ZmHOX2a(2)         <---------ANAC46                                        <--
              --------->AGP1             <---------ANAC55(2)                                     ===
              xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)--------->RVE1(2)                               ----
              --------->GATA12           --------->ANAC55(2)                                    <---
              --------->RVE1(2)          <---------ANAC55(1)                                    ----
              <---------ARR11(2)         <---------TGA1a                          --------->ANAC58
              <---------ARR11(3)         --------->O2                             --------->ANAC58
              --------->ARR11(3)         --------->TGA1a                       --------->ZAT2   <---
              <---------GATA12           --------->bZIP60(1)        ================================
              --------->ARR11(2)        ----------->STF1            <------ZmHOX2a(1)           ----
              --------->ARR14(2)        <-----------------------TaNAC69(2)     --------->At4g35610 <
-DOF5.7(1)    <---------ARR14(2)      ----------->TGA1   --------->GATA12      <---------At4g35610--
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)   ----------->HVH21  <---------GATA12      <---------ZAT2   <---
ccattgctcaagctcaagatccaatggtgacagtagctcgagtgacgtgaaaatcaactcgatcgaagtcaggaacaagttcagctcgcaaacagtcgcg  6943200
  xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                    <---------HSFB2a(2)
  --------->DREB2C(2)                                   --------->HSFB2a(2)
 <---------LBD16                             <------ZmHOX2a(2)
--------->MYB52(1)                           --------->CCA1(2)
xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)          --------->AGP1 <---------ARR11(3)
----ZmHOX2a(2)                              <---------ARR11(3)
===========================HOX2a_HOX2a      --------->GATA12
----->GATA12 <---------GLK1(2)              --------->RVE1(2)
------GATA12--------->YAB5                  <---------ARR11(2)
----->ARR14(2)                              --------->ARR11(2)
------ARR11(2)                              <---------ARR14(2)
====HOX2a_HOX2a                 ------>ZmHOX2a(1)       --------->HSFC1(1)
----->ARR11(2)                  ====================HOX2a_HOX2a
---------ALFIN1     --------->At4g35610     <---------GATA12             <---------YAB5         ----
------->MYB46(3)    ================================HOX2a_HOX2a       <---------YAB5      --------->ANAC55(2)
------ARR14(2)      ------>ZmHOX2a(1)       --------->ARR14(2)   --------->HSFB2a(2)      <---------ANAC55(2)
atccaccggcattgatgattctcctctgaattctcctcaagttgctagatccaagacttctagagcttcgcgagtcatcgtttcaccgaaatcaagtgat  6943300
       <---------At5g28300                     --------->ARR11(3)                          <--------
      --------->YAB1                           <---------ARR11(3)                          <--------
     --------->MYB46(3)              --------->LBD16      <---------YAB5                   <--------
     <---------ATHB12          <---------ATHB12--------->RVE1(2)                    <---------GATA12
   --------->WOX13(1)          <------ZmHOX2a(2)   --------->At4g35610  <---------MYB52(2) ---------
-->ZmHOX2a(2)          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)    --------->ICU4    <---------RVE1(2)
ccaactcaatcaccgttcttcttgcacagtgccgatcatccaggtttgaatatcatctctcatcgtcttgatgaaacgaactatggagattggaatgttg  6943400
                           <---------GATA12                             <---------KAN1
                           <---------ARR14(2)               ------>ZmHOX2a(1)
                           --------->GATA12                 <----------DOF2 <---------ARR11(3)
         --------->TOE2(3) --------->GLK1(2)               <---------DOF5.7(1) <----------DOF2
        <---------ANAC58   --------->ARR14(2)            ---------->ID1<---------ARR11(2)
---RAV1(1)    <---------RVE1(2)                        xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)      ----
-HSFB2a(1)  --------->MYB52(2)                         --------->bZIP60(2)  --------->ARR11(3)  <---
-KAN1   <---------ANAC58<---------KAN1        <---------GLK1(1)        --------->ARR11(2)    -------
>HSFB2a(1)<---------MYB52(1)     --------->GATA12  ------>NtERF2  --------->MYB52(1)         <------
caatgctcatttcgttagatgttaagaacaaatctggatttatagatggaactctgcctcgtcctttagaaacggataagaacttttgtctatggtctag  6943500
<- Previous    Next ->

AGI:  At2g15920.1   
Description:  transposable element gene. copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea)
Range:  from: 6943021    to: 6947487    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.