Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                     --------->RVE1(2)
                                                                                     <---------GATA12
                                                                                     --------->GATA12
                                                                               <------ZmHOX2a(2)
                                                                              --------->GATA12------
      --------->ZAT14                                                         <---------GATA12------
------GATA12                                                                  <---------ARR11(3)
---->At4g35610                                                   ---------->DOF2------>ZmHOX2a(2) --
--At4g35610                                                  <---------ANAC46 --------->ARR11(3)  <-
 
atggagaagtgaagtatgtatagatagcttcgagggacacaaaaacacagagaaacttgaaatcgggtgaaagaaacttgagatctcaaatccaaaaccc  555700
                      ------>ZmHOX2a(2)
                     --------->CCA1(2)
                     <------ZmHOX2a(2)
                    --------->AGP1
                    <---------GATA12
                    --------->GATA12
         --------->GLK1(2)
        <---------ARR14(2)
        --------->ARR14(2)
        <---------ARR11(2)                      <---------WOX13(2)
    --------->At4g35610             --------->YAB1
    <---------At4g35610             <---------ICU4                                      --------->ANAC58
 ---------->DOF2    --------->RVE1(2)           --------->WOX13(2)                      --------->ANAC46
--->TOE1(3)         <---------AGP1 --------->ICU4 <-----------GT1                       --------->ANAC58
--->TOE2(3)         <---------ARR11(3)         --------->WOX13(1)                     <---------DOF5.7(2)
------->WOX13(2)    <-----------ARR10       --------->RVE1(2)     ---------->DOF2    --------->ARR11(2)
--------WOX13(2)    --------->ARR11(3) --------->YAB1        <---------TOE1(2)  ---------->DOF2
 
taattgaagcagaaactggataagatctaagcgaaacaataatcaaaaatcaattaccttcttgcaggttaaaggagaagcgagaaagtaaacgcaatcg  555800
                                                                                                   <
                                                                                                 ---
                                                                                                 <--
                                                                                                <---
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                             <------
                                                                                             -------
                                                                                   <---------ATERF1(1)
                                                                        <-------GAMYB       --------
                                                                       <---------MYB46(3)  <--------
                                                                      <---------ANAC58     ---------
                                                                      <---------RAP2.6(2) <---------ATHB12
                                                                      <---------ANAC58    --------->ICU4
                                                                     <---------LBD16 --------->RAP2.6(2)
                                                      --------->At4g35610         <---------DEAR3(1)
                                         --------->ATHB12  <-----------RAV1(1)   --------->ATERF1(1)
                                        <---------YAB1<---------At4g35610<---------MYB52(1)---------
                          <---------At4g35610      <---------At4g35610<---------ANAC46 <------NtERF2
                          --------->At4g35610 <---------ANAC58    <-------GAMYB  <-----------RAV1(2)
        ---------->DOF2--------->At4g35610    <---------ANAC58   ============================RAV----
  <---------ALFIN1     <---------At4g35610 <---------WOX13(1)    <-----------RAV1(1)--------->RAP2.3(1)
 
gtgttccacttcaaagcatcttcttcagcagatgaaacagtctctgattgcttcttctgctcatgttgctgttgcggttgagtcgcaggcgcaaacatta  555900
  <---------ANAC46
  <---------ANAC58
  <---------ANAC58
---------YAB1
------>YAB1
-------ICU4
------YAB1
---->AHL20(3)                                                            --------->RVE1(2)
-----AHL25(2)                                                           <---------KAN1
---->AHL12(2)                                                       ----------->GT1
-----AHL20(3)                                                     <---------ARR11(3)
---->AHL25(2)           <----------DOF2                           --------->ARR11(3)
----ICU4               <---------DOF5.7(1)                    <------ZmHOX2a(1)
---YAB1           <---------KAN1                 <---------GATA12 --------->GATA12
-->ICU4          ------->TEIL                    --------->GATA12 --------->RVE1(2)
->TOE2(3)<---------HSFB2a(1)                     --------->RVE1(2)<---------GATA12
-ICU4    --------->HSFC1(2)         =================================HOX2a_HOX2a                ----
>YAB1    <---------HSFC1(2)         ------>ZmHOX2a(2)     --------->TOE1(2)<-----------GT1     <----
>YAB5    --------->HSFB2a(1)      <---------GATA12===================HOX2a_HOX2a               -----
----->ICU4      <---------GLK1(2) --------->GATA12<------ZmHOX2a(2)<------ZmHOX2a(2)           <----
 
ttattacttggaaatttctgaatctctctttcaagtagatcgcaaggtttcagatcgaaaccctaggaagatcgaaaatcaccgattcagagagagtccc  556000
                                  --------->ZAT18
                             --------->DOF5.7(1)
                             ---------->DOF2
                        ----------->RAV1(1)
                       <------NtERF2
                      ------>NtERF2 ----------->RAV1(1)
                      <---------ATERF1(1)
                     --------->RAP2.3(3)
                     --------->RRTF1(2)
                     --------->RRTF1(3)
                     --------->RAP2.3(2)
                     --------->ANAC46
                     --------->ANAC58
                     >>>>>>>>>AtERF-2
                     --------->RAP2.6(2)
                     --------->DEAR3(1)
                     <---------ATERF1(2)
                     >>>>>>>>>AtERF-3
                     --------->ATERF1(2)
                     --------->ANAC58
                     >>>>>>>>>AtERF-1
                     >>>>>>>>>AtERF-5
                     >>>>>>>>>AtERF-4
                     >>>>>>>>>AtERF-7
                     >>>>>>>>>>AtTINY2
                    --------->DEAR3(2)                                 <----------DOF2
                    --------->RRTF1(1)                               --------------->AGL15
                    --------->RAP2.3(1)                              <---------------AGL15
      >>>>>>>>>TBF1 --------->ATERF1(1)                            --------->ZAT18
   >>>>>>>>>TBF1    --------->ERF1<---------ZAT18               <---------ANAC58
<XXXXXXXXXXXXXXXXXXXXMIR838---------->DOF2                      <---------ANAC58
----->LBD16         --------->MYB46(3)                    <---------ANAC46---------->DOF2
-----ANAC46        --------->ZAT2 <---------ZAT14       <---------KAN1<---------DOF5.7(1)
---->O2            <---------ATERF1(1)            --------->ANAC46 <---------ZAT18            ------
-----O2  >>>>>>>>>TBF1<---------RAP2.6(3)     --------->KAN1    --------->ALFIN1       ---------->DOF2
 
gtggaagaagaagaagaagacgagccgccacaaagagcgcaccagagagaaactcgcgactgtgtgtgtgtgccctttaaagctaagcctaaaagttttt  556100
                                                                                           <--------
                                                                                           ---------
                                                                                         <---------AHL12(1)
                                                                                         --------->AHL12(1)
                                                                                         --------->AHL25(1)
                                                                                         --------->AHL20(2)
                                                                                  --------->ALFIN1
                                                                                 <-------MYC3
                                                                                 <-------MYC4
                                                                                 ------->MYC4
                                                                                 ------->MYC3
                                                                                 ------->PIF5
                                                                                 <-------PIF5
                                                                                 ------->MYC2
                                                                                 <-------MYC2 <-----
                                                                                <<<<<<<<<<HY5-------
                                                                                <---------ANAC55(2)
                                                                                <---------TGA1a
                                                                                <---------O2 -------
           *TSS                                   <------MYB83             ----------->HVH21<-------
        <---------DOF5.7(1)       ------------>CBF<------MYB46(1)   --------->AHL20(2)   --------->AHL25(3)
       <----------DOF2           --------->RVE1(2)----------->GT1  <---------ATHB12      --------->ICU4
       <---------DOF5.7(1) ----------->GT1       --------->MYB59 --------->WOX13(1)    --------->GATA12
      <---------DOF5.7(1)<---------ANAC46 <------ZmHOX2a(2)    <---------YAB5   --------->O2<-------
   ---------->ID1     ----------->HVH21  <---------GATA12      ------------>CBF --------->TGA1a
--->AHL12(2)        --------->ANAC55(2)  --------->ARR11(3)    <---------ATHB12------------>OsbHLH66
 
ttttttggctctttttttttcttatgtgatgggaaatatcaatagatcaagttcggtttatttgtaatcaatcaaatactgacacgtggggatttattat  556200
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                       ----------->GT1
                                                                                      --------->DOF5.7(1)
-AHL12(2)                                                                             --------->DAG2
>AHL12(2)                                                       <---------KAN1    --------->YAB1
-------CBF                      --------->YAB1   --------->MYB46(3)              <---------ATHB12
-->ATHB51                      <---------YAB1  <---------ARR11(2)                <---------YAB1
-->ATHB12                   <---------RVE1(2)  --------->ARR11(2)  <---------ANAC46   <---------TOE2(3)
--YAB1             <---------ANAC58      <---------YAB1  <----------DOF2         --------->ICU4    <
--YAB5             <---------ANAC58<-----------GT1--------->TOE1(2)----------->GT1--------->YAB5<---
 
tggtttatttgttagccatattgtttgccttgatattataacttctgatggaaccagcgactttggaatgttgtgaaatagacaatgataaggtgattta  556300
                                                                            <---------AHL20(2)
                                                                           <---------AHL25(3)
                                    <----------DOF2                        --------->AHL25(3)
                                   ===============================HOX2a_HOX2a
                                   ------>ZmHOX2a(2)                       --------->AHL25(2)
                                  <------ZmHOX2a(2)                        --------->AHL12(3)
                                  ================================HOX2a_HOX2a
                                  <---------RVE1(1)                        <---------AHL20(2)
                                 <---------GATA12                          <---------AHL25(1)
                                 --------->ARR11(3)                        --------->AHL20(2)
                                 --------->GATA12                          --------->AHL25(1)
                                 <---------ARR14(2)                        <---------AHL12(3)
                                 <---------ARR11(3)                  --------->TOE2(3)
                                 <---------AGP1               <---------GATA12
                                 <---------RVE1(2)            --------->RVE1(2)
                                 --------->ARR14(2)           --------->GATA12
 ------>MYB83                   <---------CCA1(2)             <-----------ARR10
 ------>MYB46(1)              <--------P                   <------ZmHOX2a(1)<---------AHL25(3)
----AHL25(1)                <------MYB46(1)              --------->ANAC58<---------WOX13(2)
--->AHL25(1)                <------MYB83    <<<<<<<<<ARR2--------->ANAC58--------->WOX13(2) --------
----AHL20(2)               <---------MYB46(3)    --------->ATHB12   --------->MYB46(3)    --------->RVE1(2)
---------MYB59           <---------MYB52(1) <---------ATHB12 --------->GLK1(1)--------->GATA12
--------GT1             --------->ATHB12   --------->RVE1(2) <---------GLK1(1)<---------GATA12
 
aaccgaacttgaaccaaaattgtaaaccgattggtagatcttttacaatcaaacattggtaaggaaatctaaccaaaattaaatccaaaccaaaatcaaa  556400
                                               ------>ZmHOX2a(2)
                                              --------->GLK1(1)
                                              <---------GLK1(1)
                                              <------ZmHOX2a(2)
                                             --------->ARR14(2)
                                             --------->RVE1(2)
                                             <---------ARR14(2)
                                             <---------GATA12
                                             <---------ARR11(3)
                                             --------->GATA12
                                             --------->ARR14(3)                   <---------MYB52(2)
                                             <---------ARR14(3)              --------->ANAC58  -----
                                             --------->ARR11(3)              --------->ANAC58  -----
                      --------->ARR11(3)     <---------AGP1                ---------->DOF2<------ZmHOX2a(2)
                      <---------ARR11(3)    <---------KAN1           <---------GATA12    --------->RVE1(2)
                   ==================================HOX2a_HOX2a     <---------------AtSPL8    -----
                   ===================================HOX2a_HOX2a    --------->GATA12---------->DOF2
   <<<<<<<<<MYB2   <------ZmHOX2a(1)--------->KAN1                   <---------ARR11(3)  <---------ARR11(3)
->YAB1    <----------DOF2          <---------KAN1                    --------->ARR11(3)  --------->ARR11(3)
 
actttggttttcactttggtaaggacatcttgaaccgagtaattcgaagatctctcaaaaccaaaatttgaagatgtacaaagcaactaaaagatcacaa  556500
                                        --------->DOF5.7(1)
                                <---------YAB1
                              --------->YAB5                             --------->YAB1
          ---------->DOF2    --------->ICU4                      --------->RVE1(2)     <---------GATA12
---->ANAC58                  <---------ATHB12              <-----------GT1             --------->GATA12
---->ANAC58         <---------YAB1    ---------->DOF2   <---------WOX13(2)       <------ZmHOX2a(1)
---->ANAC46    <----------DOF2--------->YAB1            --------->WOX13(2)      <---------YAB1    --
 
gaaataagtttttcaaagcttttattatacaaatgatgatagaaagatgtgttcttgagaattaacaacatcacattcacaataggattggatttaagaa  556600
<- Previous    Next ->

AGI:  At2g02160.1   
Description:  zinc finger (CCCH-type) family protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO15426.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571)
Range:  from: 553109    to: 556112    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g02170.1   
Description:  remorin family protein. similar to remorin family protein [Arabidopsis thaliana] (TAIR:AT1G30320.1); similar to hypothetical protein OsI_005438 [Oryza sativa (indica cultivar-group)] (GB:EAY84205.1); contains InterPro domain Remorin, C-terminal region (InterPro:IPR005516)
Range:  from: 556492    to: 558797    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.