Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           <---------YAB1                                                      --------->AtLEC2
          --------->WOX13(2)                                                   ------>MYB83
         --------->YAB1                                                        ------>MYB46(1)
         --------->YAB5          --------->DOF5.7(1)                         ------->GAMYB
         <--------HAHB4          <---------TOE2(3)                     <---------ICU4
        <---------YAB1     <---------AHL25(3)                          --------->YAB1
  <---------ZAT18          --------->AHL20(2)                          --------->YAB5
  --------->ZAT14         --------->AHL20(2)    <---------TOE2(3)     <---------YAB1
 <---------ANAC58        <---------WOX13(2)    >>>>>>>>>WRKY18       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
 <---------ANAC46    --------->At5g28300--------->GATA12    ------>NtERF2   --------->MYB46(3)
 <---------ANAC58   ----------->GT1   xxxxxxxxxxxxxxxx>smallRNA(i)  --------->YAB1
--------------->AtSPL8  <---------WOX13(2)------>ZmHOX2a(2) <------NtERF2 <-----------GT1         --
----->AtMYB61 <---------TOE2(3) --------->DOF5.7(1)      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)    <-
---->ZAT14--------->AHL12(2)   ---------->DOF2--------->WRKY12<---------DOF5.7(1)        --------->KAN1
-----ZAT14<---------WOX13(2)   --------->DOF5.7(1)   <---------KAN1 ------->GAMYB     --------->TOE1(3)
-->ANAC46xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)  ----------->HVH21    --------->MYB46(3) --------->TOE2(3)
cactgcgtactataattaatgaatggtaaataaaaaaaggtttgatccattgacgattttgtccgccttaaccatcataaccatccaaaccctaattcta  163600
              ---------->DOF2                                                              ------->MYC3
       --------->ALFIN1                                                      --------->ANAC55(2)
      ------->MYC3                                                    --------->ANAC58  <---------AtLEC2
      <-------MYC3        --------->AHL20(2)                          --------->ANAC58  <---------ANAC46
     <---------O2       --------->WOX13(2)                            --------->ANAC46  <---------ANAC58
     --------->O2       <---------WOX13(2) --------->KAN1      <---------GATA12         <---------ANAC58
------->AHL12(1)    ----------->GT1     <---------RVE1(2)      --------->GATA12    <---------ICU4
--------AHL12(1)--------->DOF5.7(1) ----------->GT1            ------->TEIL  --------->TOE2(3)    --
aaatttcaacgtggcagaaaagaaggtaattgaataacaaggtgatatactcttgaaataaacatgaatctacaagctatacttaatagttgcatgtgat  163700
                                                           --------->AHL20(2) --------->AHL20(3)
                                                           <---------AHL20(2) <---------AHL25(1)   -
                                             <---------GATA12    --------->ANAC58--------->AHL12(3)-
                                            <---------GLK1(1)   --------->DOF5.7(1)<---------ICU4  <
                                    --------->AHL20(2)   --------->WOX13(2)   <---------AHL20(2) ---
                           --------------->AtSPL8        <---------WOX13(2)   --------->AHL20(2) <--
                           --------------->AtSPL3       <---------ICU4<---------ATHB12    <---------ANAC58
--->HVH21                  <---------------AtSPL8      --------->ICU4<---------RAP2.6(3)  <---------ANAC58
------->ZAT18           <---------ZAT6      --------->GLK1(1)  ---------->DOF2<---------AHL12(3) <--
gcgcacgagtaccatcttgttgaaatagtggtagtacaatttaagagaaatccaaatactaattaaaaaagccatcatgattaaaataattaggcttgaa  163800
                                    --------->AHL25(1)          <---------ARR11(2)
                                    --------->AHL20(2)          <---------ARR11(1)
                                    --------->AHL12(1)          ------->TEIL
                                   --------->AHL25(1)           <---------ARR14(2)
                                   --------->AHL25(3)           --------->ARR11(2)
                                   <---------AHL20(3)           --------->RVE1(2)
            --------->DAG2         <---------AHL12(3)           --------->ARR14(2)
            --------->DOF5.7(1)    --------->AHL20(3)          <---------CCA1(2)
  --------->ANAC55(2)         <---------TOE2(3)              --------->ANAC55(1)
 <---------TOE2(2)        <---------AHL12(2)                 --------->ANAC46                  <----
 <---------TOE1(2)        <---------WOX13(2)                 --------->ANAC55(2)               -----
 --------->SPL7(1)        --------->WOX13(2)            --------->ARR11(2)                     <----
-------->TOE1(2)        --------->AHL20(2)           <--------HAHB4                            -----
-------->TOE2(2)        --------->AHL25(1)          <---------YAB1                             <----
---------SPL7(1)        --------->AHL25(3)--------->DOF5.7(1)--------->ANAC58            ------->MYC3
------------>AtSPL3    <---------MYB52(1)<---------AHL20(2)  --------->ANAC58    -------->P  -------
-------------AtSPL3   <---------WOX13(2)--------->AHL20(2)   --------->O2     <---------DOF5.7(1)
-------------AtSPL8---------->ID1  --------->AHL20(2)<---------ICU4     --------->RVE1(2)<-------MYC3
atcgtacgtagtcaaaaggtttgtccattaattaagaaattaataaaaatggaccatcatttccacgtatctacaaatctctcttacccccatatgcaca  163900
      --------->ANAC58                            <---------YAB5
      --------->ANAC58                            <---------ATHB12
     ------->TEIL                         ------>NtERF2
 --------->At4g35610                     --------->DREB2C(2)
 <---------At4g35610                     --------->DEAR3(1)                           <-----------HVH21
---MYC4                  --------->MYB52(1)     --------->WOX13(1)                 <---------ANAC58
-->MYC3          ---------->DOF2      <---------ALFIN1                             <---------ANAC58
---MYC3         <---------AHL20(2)  --------->AtMYB61                        <---------ANAC58
-->MYC2     <--------HAHB4         --------->bZIP60(2)                    ------>ZmHOX2a(1)
---MYC2    <---------ATHB12       -------->P  ------------>CBF            <----------DOF2
>TEIL--------->SPL7(1)  <---------ALFIN1--------->DEAR4(2) --------->RVE1(2) <---------ANAC58
tgtctgcgaaccccatcatttaaagccccaacgtagcaacctcaccgccttcaatcatcaaacatccaaactctatcctttcgttttcttgtcagacaaa  164000
                              --------->ANAC58                                           --------->ATERF1(1)
                           <------NtERF2 ---------->DOF2                                <---------ATERF1(1)
                          ------>NtERF2 --------->AtMYB61                              ----------->HVH21
                         --------->ATERF1(2)                <------NtERF2              ----------->TGA1
                         <---------ATERF1(2)                <---------------------WRI1<-----------HVH21
                         <---------RAP2.6(2)              <---------DEAR3(1)         --------->At4g35610
              --------->MYB52(1)    <----------ID1    --------->CCA1(2)              <---------At4g35610
             ----------->HVH21--------->ANAC58     <---------YAB1                    --------->LBD16
  --------->ZAT6         <---------DEAR3(1)     --------->ICU4     <----------DOF2 <---------LBD16<-
aactaatactagatgggtaacagtttaggcggcaagaaaacgaccaaagtcatgaagatagacggcgagacttttaaactgaaaactccggtgacggctg  164100
                        --------->bZIP60(2)             --------->ZAT14
                        --------->ANAC58                <---------ZAT14
                        --------->O2              --------->ANAC58
                        <---------O2              --------->ANAC58
                        --------->ANAC58        ---------->DOF2
                    <-----------HVH21          --------->WRKY18(1)
                    ------>NtERF2              <---------MYB52(1)
                   ------>NtERF2              <-----------HVH21
                  --------->LBD16          <---------KAN1
 <---------ARR11(3)--------->ANAC46       --------->GATA12
 --------->ARR11(3)--------->LBD16        --------->RVE1(2)
--At4g35610  =====================bZIP_DOF--------->ARR14(2)
->At4g35610  <----------DOF2              --------->GLK1(2)                               --------->AHL12(2)
--ZAT2 ---------->DOF2<---------ALFIN1    --------->ARR11(2)             --------->MYB46(3)
-----ZmHOX2a(1)  <---------LBD16          <---------ARR14(2) ------>NtERF2      <---------TOE2(3)  <
aggaggtcttaaaagactttcccggccacgtcttgttagactccgaatccgtcaagcactacggtgcccgagccaaaccacttgaggtatgttttttttt  164200
                                                      <---------WOX13(1)     --------->MYB111(1)
                                                     <---------RVE1(2)       --------->MYB46(2)  <--
                                <-----------GT1    <---------YAB1     <-----------RAV1(1)    <XXXXXX
                         <---------ANAC46   --------->YAB1            ==========================RAV<
                         <---------ANAC58  <---------ATHB12          <---------TOE2(3)      --------
     --------->YAB1      <---------ANAC58  <---------YAB5      ----------->GT1<------MYB83  <-------
-----------GT1      <---------YAB1     --------->ANAC46    ---------->DOF2   <---------AtMYB61  <---
tttttctatcagaactatatgttatgtttcttgttaaactatacgaatcatgttttgatagacaaagcgtttaatgttgtttggtgtgcaggcgaagcag  164300
                                        --------->DOF5.7(1)                  <-------MYC3
                                      ---------->DOF2                       --------->ANAC46
                                    ----------->HVH21                       <---------O2
                                 <---------DEAR3(1)                         --------->TGA1a
                                <------NtERF2                               <---------ANAC55(2)
                                --------->ATERF1(1)                         --------->ANAC55(2)
                              --------->TCP20                               <---------TGA1a
                              --------->TCP16(1)                            --------->O2
                              <---------PCF2                              ------------->DYT1
     <------NtERF2            <---------ARR14(2)                     <------ZmHOX2a(1)
 <------MYB83                 <---------ARR11(2)                 <------ZmHOX2a(2)
 <------MYB46(1)           --------->ALFIN1                     <---------GATA12
--------->ALFIN1         <---------ANAC46                       <---------ARR11(3)     --------->DOF5.7(1)
--------->MYB111(2)     <-----------RAV1(1)    --------->ZAT18  --------->GATA12     ---------->DOF2
-------MYB46(3)         <---------AtMYB61      --------->ETT(2) --------->ARR11(3) <---------ZAT14
XXXXXXXXXXXXXXMIR773  <-----------RAV1(1)   <---------KAN1    ----------->ARR10    --------->ZAT18
--------P <---------At4g35610--------->ATERF1(1)          ----------->GT1 <-------------DYT1
->At4g35610    <---------DOF5.7(1)--------->LBD16       --------->DOF5.7(1) ====================bZIP_DOF
--At4g35610<---------RAP2.6(2)--------->ARR11(2)    <---------HSFB2a(2)<---------GLK1(1)       <----
------AtMYB61  <----------DOF2--------->ARR14(2)    --------->HSFB2a(2)--------->GLK1(1)       <----
aggttggaggcgaagcggctttattttgtggtggagccggtgaaagagtgtccaccgagaagggtaagatcaggaattcacgtgagtgcaaaggagaggc  164400
                     <---------GATA12                            ----------->HVH21
                    <---------GLK1(1)                      <------ZmHOX2a(1)
                 --------->LBD16  =============================HOX2a_HOX2a                        --
                <------NtERF2    <------ZmHOX2a(2)      <------ZmHOX2a(1)                --------->ALFIN1
          <---------ANAC58       ==============================HOX2a_HOX2a              <-----------HVH21
          <---------ANAC58       =================================HOX2a_HOX2a         <---------DEAR3(1)
         --------->ZAT2------>ZmHOX2a(2)             <-----------RAV1(2)           <------ZmHOX2a(1)
      --------->KAN1--------->GLK1(1)             --------->AtMYB61               --------->DOF5.7(1)
-----ANAC58    <---------LBD16  --------->GATA12 --------->MYB46(3)          >>>>>>>>>TBF1    ------
-----ANAC58 ------>NtERF2       <---------GATA12 <---------MYB55(2)      <------ZmHOX2a(1)   <------ZmHOX2a(1)
ttgagagtctcatgctggcccggagatcgtcttccgatctctccatactcaaaccaccaggaggatggacgacggaggaagaagaaggagcggtgaggag  164500
<- Previous    Next ->

AGI:  At2g01340.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G71015.1); similar to unknown [Glycine max] (GB:AAG38147.1); contains InterPro domain Trigger factor, C-terminal, bacterial; (InterPro:IPR008880)
Range:  from: 163953    to: 165289    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.