Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
<---------WOX13(2)                                                   <---------ZAT2
--------->WOX13(2)                                                   --------->ZAT2
-------AHL20(2)                                                      <---------At4g35610
------>AHL20(2)                                                      --------->At4g35610
-------AHL12(3)                                                     --------->MYB52(2)
-------AHL25(3)                                                   <---------MYB52(1)
------>AHL25(3)                                                 <------MYB46(1)
------>AHL12(3)                                             <---------RVE1(2)
-------AHL25(1)                <----------DOF2             --------->ATHB12
------>AHL25(1)     <---------AHL20(2)                    <---------YAB1 ----------->ARR10   <------
----WOX13(2)       <---------DOF5.7(1)        ------>ZmHOX2a(1) <------MYB83 ----------->RAV1(2)
ttaaatttagatccggtttccatttttttgatgactttggtttgttttcctattactaattttgatttggttagctgagagcctgagactgagaggcttt  29847300
                   <---------At4g35610             <---------AHL12(2)
                   --------->At4g35610             <---------WOX13(2)                 --------->MYB59
                  <---------RVE1(2)                --------->WOX13(2)    --------->ALFIN1
       <----------DOF2--------->YAB5          ----------->GT1------>NtERF2         --------->WOX13(2)
       <---------DOF5.7(1)                  <---------ANAC58<---------ARR14(2)     <---------WOX13(2)
      <---------DAG2 ----------->HVH21      <---------ANAC46--------->ARR14(2)  <------NtERF2 <-----
      <---------DOF5.7(1)   --------->YAB1  <---------ANAC58<---------ARR11(2)  <---------RAP2.6(3)
----DOF2     <---------ANAC46           <-----------RAV1(2) --------->ARR11(2) --------->RAP2.6(2)
gttgatgacccttttgtcttggagatgacaatgagcatcaaacccaggcgtgttaattaaacggctccgtttacaagttgggccgaaattaggcctcttg  29847400
                                     --------->AHL12(2)   <---------AHL12(2)
                                   <---------DOF5.7(1)    --------->AHL25(2)
                               <---------TOE2(3)          --------->AHL20(3)
                              <-----------GT1            --------->YAB1                    <--------
                         --------->AHL20(2)              --------->AHL12(2)               <------NtERF2
          --------->ATHB12    --------->MYB52(1)        <---------KAN1                 <---------YAB5
------RAV1(1)            <---------YAB1               --------->YAB1             --------->YAB5
ttgggcttaaacctgattagtttttcttataaataacgtttttttttgttttggtaagaataataatgctcatttgtgagtcagtgactagtcgtcgtgc  29847500
                                        <-----------TGA1                    --------->RVE1(2)
                                        <-----------HVH21                  <---------CCA1(2)
                                       <---------TGA1a                     --------->GLK1(1)
                                       --------->O2                        <---------KAN1
                                       <---------O2                   <---------LBD16
                                       --------->TGA1a            --------->ARR11(2)
                                       <---------bZIP60(1)        <---------ARR14(2)
   ----------->HVH21                   --------->ANAC58           <---------ARR11(2)
 <---------ANAC58                      --------->bZIP60(1)    <---------LBD16         --------->AHL20(2)
 --------->ANAC55(2)                   <<<<<<<<<<AtbZIP1     <---------ANAC58      --------->WOX13(1)
 ----------->GT1                       --------->ANAC46      <---------ANAC46    ------------>CBF
 <---------ANAC55(2)        <---------GATA12             <---------------AGL15   <---------ATHB12
 <---------O2               --------->RVE1(2)      --------->KAN1 --------->ARR14(2) <---------ATHB12
 <---------ANAC58  --------->RVE1(2)   --------->ANAC58----------------->AGL1  --------->WOX13(1)  -
-ANAC46          <---------AHL12(1)    --------->bZIP60(2)   <---------ANAC58------------>CBF  -----
aataacgtgacaataaacaaaaaatcaaacaaatccaatgccacgtcagacaatacattccaattcgtggaaacgcgcatatcaatcaatgaaatgaatg  29847600
                      --------->AHL20(2)   --------->GATA12                               --------->GLK1(2)
          --------->TOE1(3)--------->AHL25(1)                                           --------->KAN1
          --------->TOE2(3)--------->AHL20(1)                                          <---------GLK1(2)
          --------->YAB1   <---------AHL20(1)                                          <---------RVE1(2)
      --------->KAN1----------->GT1    --------->ARR11(3)      *TSS               ------>NtERF2
      --------->AHL25(1)   --------->AHL25(3)        <---------AtMYB61           ----------->HVH21
      --------->AHL12(1)   <---------AHL25(3)     <----------DOF2              --------->At4g35610
      <---------AHL12(1)   --------->AHL20(2)------>ZmHOX2a(2) --------->YAB1  <---------At4g35610
 ----------->GT1   --------->DAG2      <---------ARR11(3)     <---------KAN1  ------>ZmHOX2a(2) <---
--------->DOF2    ---------->DOF2--------->CCA1(2)<---------DAG2            <---------GATA12   -----
---->YAB5<---------YAB5   --------->YAB1<------ZmHOX2a(2)--------->ETT(1)   --------->GATA12   <----
aataaagaaataatcttagccaaaagtaaatataatatataagatcgatctcacttttggtcggaataagaagctattggatcgctgacagataatccga  29847700
                                                    <------NtERF2                              -----
                                                   <---------ORA47(2)                         <-----
                                                   <---------DEAR4(2)                         <-----
                                                  <---------DEAR3(1)                         <------
                                                  --------->ALFIN1                           <------
                                                  <---------DREB2C(2)           --------->MYB46(3)
                                               --------->DOF5.7(1)            <---------ARR11(2)   -
  <-------TEIL                                --------->DOF5.7(1)   <---------WOX13(2)      --------
<---------GATA12               <-----------GT1--------->DAG2        --------->WOX13(2)     <--------
--------->GATA12            <---------DOF5.7(1)--------->DAG2      --------->WOX13(1)   <------NtERF2
--------->ARR14(2)      <------ZmHOX2a(2)    --------->DOF5.7(1) <------ZmHOX2a(2)     --------->LBD16
<---------ARR14(2)     --------->ARR11(3)    ---------->DOF2     ===================HOX2a_HOX2a<----
<---------GLK1(2)      <---------ARR11(3)<----------ID1 <----------DOF2       --------->ARR11(2)   <
---ZmHOX2a(2)          --------->GATA12--------->YAB5   <---------YAB1       <------ZmHOX2a(1)<-----
---->GATA12        <------ZmHOX2a(2)  ----------->TGA1 <---------ANAC58    --------->LBD16 <--------
-----GATA12       <-----------HVH21   <---------ATHB12 <---------ANAC58   <---------LBD16-----------
tcagattcagagagttttatcgatcagatcattttttctcaatgacgaaaaaggcggtgcttattgggatcaattacccaggaaccaaggcggagttacg  29847800
  <---------ANAC58                                          <------ZmHOX2a(1)
  <---------ANAC46                                       --------->LBD16
  <---------ANAC58                                <---------GLK1(2)
 <-------TEIL                                  --------->ANAC58
---->LBD16                                     <---------RAP2.6(2)
----ANAC58                                     --------->ANAC58
----ANAC46                                    --------->SPL7(1)
---LBD16                                      --------->RAP2.6(3)
-----------------TaNAC69(2)                   --------->SPL1(2)
-------->ARR11(2)                            --------->ARR11(2)                                 ----
->CCA1(2)                                    <---------ARR11(2)                             <-------
-ARR14(2)                                 --------------->AtSPL3                            --------
-----LBD16           <---------TOE1(2)    <---------------AtSPL3                            ------->TEIL
---------ARR11(2)    <---------TOE2(2)--------->WRKY12   --------->HSFB2a(2)                --------
----ANAC58    <-------TEIL            --------->WRKY38(1)<---------HSFB2a(2)                <-------
-ARR11(2)  --------->KAN1          <---------ANAC46<----------DOF2          <---------YAB1--------->YAB5
>ARR10<---------DOF5.7(2)     <---------KAN1<---------SPL7(1)    <---------KAN1     ------>NtERF2  <
gggatgcgtcaacgatgttcgtcgtatgtacaaatgtctcgttgaacggtacggcttctccgaggagaacatcaccgttctcatcgacaccgatgaatcc  29847900
                             <---------ZAT18              --------->ARR14(2)
                           ------>NtERF2                  --------->ARR11(2)
                           <------NtERF2                  --------->GLK1(2)
                          --------->DEAR3(1)              <---------ARR11(2)
                         --------->ATERF1(1)      --------->HSFB2a(1)
                         <---------DEAR3(1)       <---------KAN1<---------DEAR3(1)
                        ------>NtERF2            <---------ARR14(2)                               --
                        --------->LBD16          --------->ARR11(2)                             <---
                      --------->MYB46(3)         --------->GLK1(2)                            ------
                    <---------ARR14(2)           --------->GATA12                             ------
                    --------->ARR14(2)           --------->ARR14(2)    <---------ANAC58       ------
                    <---------GATA12             <---------GATA12------>NtERF2             <--------
    <---------At4g35610--------->ANAC46          <---------ARR11(2)    <---------ANAC58    <--------
    --------->At4g35610------->GAMYB             <-----------ARR10<------NtERF2            <--------
--------->ANAC46    --------->GATA12             <---------ARR11(1)--------->KAN1        --------->ZAT14
-->ZmHOX2a(1)      --------->KAN1                ------->TEIL<---------LBD16             <---------ZAT18
--ARR11(2)         --------->HSFB2a(1)   ------>ZmHOX2a(2)<---------ARR14(2)        --------->ZAT14
->ARR14(2)         <---------HSFB2a(1) <---------GATA12  <---------ARR11(2)         <---------ZAT14<
->ARR11(2)     --------->ANAC58        --------->GATA12  --------->ARR14(2)      <---------WOX13(2)<
--ARR14(2)     --------->ANAC58        --------->ARR11(3)<---------ARR14(2)---------->ID1<---------ZAT14
---------REM1(2)   <---------KAN1  <---------At4g35610----------------->AGL1    --------->YAB5------
tctactcagcctactggcaagaacatccgccgcgcgcttgctgatctcgtcgaatctgccgattccggcgacgttcttgtcgttcattacagtggacacg  29848000
--->ANAC58<---------At4g35610                                             <---------YAB1
--->ANAC58--------->At4g35610                                          --------->GLK1(2)
-REM1(2)<---------ATERF1(2)                                <---------ANAC58
-ARR14(2)------>NtERF2                                     <---------ANAC58
-ARR11(2)--------->LBD16                                   <---------ANAC46--------->YAB5
---------TOE2(1)                                          --------->MYB52(2)
---------TOE1(1)              ----------->HVH21   <---------ZAT14      <---------GATA12     <-------
--->ANAC46<---------ZAT2    --------->YAB5       <---------KAN1        ------->TEIL        <--------
gtacgaggttgccggctgagactggtgaagacgatgacactggtttcgacgagtgtattgttccttgcgacatgaatctgattactggtgagttttatct  29848100
                                 <---------ARR14(2)  <---------ARR11(3)
                                 <---------ARR11(2)  --------->ARR11(3)
                            ----------->HVH21   --------->At4g35610
                           ------>ZmHOX2a(2)  --------->YAB1
               --------->ATHB12  <---------GATA12    --------->GLK1(2)
             <---------WOX13(1)  <---------ARR11(3) <---------GLK1(2)
  <---------DOF5.7(1)     <------ZmHOX2a(2)  <---------YAB5                  --------->AHL12(1) ----
 <----------DOF2         --------->GATA12<---------AHL25(2)                <---------RVE1(2)  <-----
<---------DOF5.7(1)      <---------GATA12<---------AHL20(3)              <---------YAB1       <-----
----GT1   <---------YAB1 <---------ARR14(2)--------->YAB1          --------->DAG2             ------
---GT1    <---------YAB5 --------->ARR14(2)<---------ICU4         ---------->DOF2             <-----
ctctcttttttttgtgattgatggctacgatctgacgatcctataataatcagaagaatcttttgatggaaaagttttgattttttgtagaattgttgat  29848200
<- Previous    Next ->

AGI:  At1g79340.1   
Description:  ATMC4 (METACASPASE 4); caspase/ cysteine-type peptidase. similar to AMC6/ATMC5/ATMCP2B (TYPE-II METACASPASES), caspase/ cysteine-type endopeptidase [Arabidopsis thaliana] (TAIR:AT1G79330.1); similar to latex-abundant protein [Hevea brasiliensis] (GB:AAD13216.1); contains InterPro domain Peptidase C14, caspase catalytic; (InterPro:IPR011600)
Range:  from: 29847664    to: 29849531    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.