Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                               <------ZmHOX2a(2)               <---------ARR11(2)              -----
                              --------->ARR11(3)               --------->AGP1                  <----
                              <---------ARR11(3)               --------->ARR11(3)              -----
                              <---------RVE1(2)                --------->RVE1(2)               <----
                     --------->ARR11(2)                       --------->At4g35610              <----
                  <---------ANAC58                         <---------At4g35610    <-----------RAV1(1)
                  <---------ANAC46   --------->ARR11(3)  --------->REM1(1)    <----------DOF2  -----
--------------->AGL15<---------ARR11(2)               <---------ANAC58   --------->ARR11(3)    <----
---------GT1      <---------ANAC58   <---------RVE1(2)<---------ANAC58   <---------ARR11(3)   <-----
ttaccttgttgagccatctctgcgtatagattagatcatagatgttggaacaatatggcttcatcagatccaggaagatgtctttttgttgttgttcata  26193100
                                <-----------RAV1(1)                        <---------GATA12
                              --------->CCA1(2)                            <---------ARR11(3)
  ------>ZmHOX2a(1)         --------->YAB1                                 --------->GATA12
  --------->LBD16          <---------YAB5            <----------DOF2    ----------->RAV1(1)
---->ARR14(2)             <---------WOX13(1)      <-----------GT1      --------->ANAC46
-----ARR11(3)          <---------ATHB12      <---------ANAC58     <---------ICU4
---->ARR11(3)          <---------YAB5        <---------ANAC58     --------->YAB1
-------ARR10           <---------YAB1   <---------ANAC58         --------->MYB46(3)
-----ARR11(1)    <---------ARR11(3)     <---------ANAC58         <---------YAB5
---->RVE1(2)     --------->ARR11(3)    --------->At4g35610       <---------ATHB12       <---------HSFB2a(2)
-----ARR14(2)    --------->RVE1(2)     <---------At4g35610  ------>ZmHOX2a(1) <---------HSFB2a(2)
----CCA1(2)     <---------CCA1(2)    <--------P <---------DOF5.7(1)  --------->AtMYB61  --------->HSFB2a(2)
tcttcctgagaacaatagtatatctaatgaatgatatgtggtagcttagcgtttttctttctcctctaatcaccacaacatctggaatcacctcgaagaa  26193200
                                                         ------->TEIL             <---------YAB1<---
                                                     --------->HSFB2a(2)        --------->YAB5------
                          <---------TOE2(3)    <---------ARR11(3)              --------->ICU4 <-----
                         <-----------GT1       --------->ARR14(2)              <---------YAB5<------
                       <---------WOX13(1)      --------->GATA12            <---------YAB1 --------->AHL12(1)
                      <---------WOX13(2)       <---------ARR14(2)        --------->YAB5   --------->AHL25(3)
                      --------->WOX13(2)       <-----------ARR10         --------->ATHB12 <---------AHL12(1)
                     --------->YAB5<-------TEIL<---------GATA12          <---------ICU4   --------->AHL20(2)
                --------->DAG2  <------MYB83  <---------CCA1(2)         --------->ICU4    --------->ICU4
               ---------->DOF2  <------MYB46(1)--------->ARR11(3)       <---------YAB5 --------->YAB5
cattttgagaactagaagtaaagttgattaacatttggtacatgaacacaaatcttcttgaacgttgttgaactagtgattactgattaatgaataatta  26193300
--AHL12(2)                                                                                      ----
->WOX13(2)                                                 <---------YAB5                      <----
--WOX13(2)                                                 --------->ICU4                     <-----
>YAB5                                                     --------->ANAC58                    ------
-ICU4     --------->TOE1(2)        --------->ANAC58       --------->ANAC58                   -------
>YAB1    --------->KAN1   <----------DOF2         --------->AHL20(3)              <---------ANAC58
>ATHB51  --------->HSFB2a(1)       --------->ANAC58<---------YAB1                 <---------ANAC58
------TOE2(3)            <----------DOF2--------->KAN1<---------ANAC55(2)         <---------ANAC46
--->AHL20(2)             <---------DOF5.7(1)      <---------AHL20(3)--------->ANAC58        <-------
----AHL20(2)     --------->DOF5.7(1)    --------->ICU4<---------YAB1--------->ANAC58      --------->YAB1
---YAB1  <---------HSFB2a(1)       --------->bZIP60(2)--------->ANAC55(2)  --------->AHL20(2)-------
aagaaaagacaaacgttcgaaagatgggcctttgggccaagtcatatttggattattatgtaagcattaacaagcccataaaatgtcgtccattgatgat  26193400
                     <---------SPL7(1)                                          <---------ANAC46
                     <-----------HVH21                                 --------->ARR11(3)
                    --------->DEAR3(1)                                 <---------ARR11(3)
  ------------>CBF --------->DEAR3(2)                                 --------->YAB1
----->YAB1         --------->MYB46(3)                              ---------->DOF2
-----YAB1         ------->TEIL                          --------->DOF5.7(1)     <---------ANAC58   <
----ARR11(3) <---------At4g35610                      ---------->DOF2----------->GT1               -
--->ARR11(3) --------->At4g35610         --------->ALFIN1    ----------------->AGL3                -
-->YAB1 <---------ANAC55(2)        <----------DOF2    --------->DOF5.7(1)--------->AHL20(2)        <
--YAB1  --------->ANAC55(2)<------ZmHOX2a(2)     ----------->GT1  <---------AHL20(2) ---------->DOF2
-->YAB5--------->RVE1(2)  --------->GATA12     ----------->GT1  ----------->TBP <---------ANAC58  *TSS
cataagtcaatatgtaatctgaaccgtccgatctagggctttaggtgttgaagtgaaaaaagaccctatataaagataatatagcttataaagtctcttc  26193500
         --------->ZAT2                                                                      -------
         <---------ZAT2                                                                      <------
         <---------At4g35610                                                         --------->ANAC58
         --------->At4g35610                                                <-----------GT1  <------
      ---------->DOF2                                                 <---------ANAC46       -------
     <---------MYB52(1)                                             ------>NtERF2    --------->ANAC58
     --------->WRKY18(1)     --------->STY1(1)                     --------->DEAR3(1)<---------bZIP60(1)
    <-----------HVH21        <---------STY1(1)                    <---------At4g35610--------->bZIP60(1)
---------At4g35610<------ZmHOX2a(1)                              <---------ATERF1(1) --------->ANAC46
-------->At4g35610----------->GT1                              <---------ZAT14     --------->YAB5
-------->ZAT2    ----------->GT1                               --------->ZAT14    <------ZmHOX2a(2)
---------ZAT2  <------ZmHOX2a(1)                           <-----------RAV1(1)   <-----------HVH21 -
tctgctccgtcaagctgaggaggataaaaaccctagggtgagtgagacagagagaagcgaaaatggtgcagcgccttgtttaccgatcacgacacagtta  26193600
     --------->RVE1(2)                                                                      <-------
    ------>MYB46(1)                                                                         <-------
    ------>MYB83                                                                            --------
  <---------MYB111(1)                                                                       --------
  --------->AtMYB61                                                                         ------->TEIL
------>NtERF2          ------>ZmHOX2a(2)                                                    <-------
----->ANAC58           ----------->GT1                                                      <-------
----->ANAC55(2)      <---------ARR11(3)                                             --------->RVE1(2)
------ANAC55(2)      <---------ARR14(2)                                             ------->TEIL
----->ANAC58         <---------ARR11(2)                                             <---------ARR11(2)
----->ANAC46         --------->ARR11(2)                                  <-----------GT1    --------
----->bZIP60(1)      --------->ARR14(2)                         --------->At4g35610 --------->ARR11(2)
------bZIP60(1)      --------->GATA12                         ------->MYC2          --------->ARR14(2)
--->KAN1  -------->P <---------GATA12                         <-------MYC3    <---------GATA12
---ARR11(2)    <---------ALFIN1                               ------->MYC3    --------->GLK1(2)
-->ARR11(2)   --------->ZAT2                                  <-------MYC2    --------->ARR14(2)
---ARR14(2) ------->GAMYB                <---------ZAT14     <----------TaMYB80    <---------CCA1(2)
---MYB52(1)--------->MYB46(3)        --------->ARR14(2)      --------->KAN1   --------->RVE1(2)
-->ARR14(2)<---------MYB55(2)      --------->LBD16           <---------KAN1   <---------ARR14(2)  --
-------->DEAR3(1)   <------ZmHOX2a(1)--------->GATA12       ---------->TaMYB80--------->GATA12------
cgccaccaaatccaaccagcacaggatcgtcaaaactccaggtctgttctgtttcttcaatcgcatatgctgaaattcacaaatctgtatccatggatct  26193700
                                                  ------->TEIL                                   ---
  --------->CCA1(2)                               --------->MYB52(1)                            ----
 <---------RVE1(2)                              <---------SPL7(1)                               <---
 --------->GATA12               <-----------RAV1(2)                                           ------
 <---------GATA12         --------->ATHB12     <---------ANAC58                               <-----
--AGP1                   <---------YAB1        <---------ANAC58                              <------
--ARR11(3)              <---------TOE2(3)      --------->ANAC55(2)                           -------
->ARR11(3)             --------->YAB1         --------------->AtSPL8                        --------
->ARR11(2)            --------->ICU4          <---------TOE2(3)                          <----------
--GATA12         --------->ANAC55(2)          --------------->AtSPL3                     -----------
--ARR11(2)       <---------ANAC58         --------->WOX13(2)                    <---------MYB59<----
->GATA12         <---------ANAC58         <---------WOX13(2)                  ------->TEIL  --------
------->YAB1     <---------ANAC46    ----------->GT1                        <---------ZAT18 <-------
>ZmHOX2a(2)     <---------TOE2(3)  <------ZmHOX2a(1)                        --------->ZAT18<--------
ataagatttgaaatgtattgacgtattgatgatttgcaggaggtaaattgacgtaccagaccactaagaagagagctagtggacctaaatgtcccgttac  26193800
---ARR11(2)                                                                                      <--
-->ARR11(2)                         <---------ARR14(2)                                          >>>>
--->HVH21                           <---------GLK1(2)                                           <---
-------AGL1                         --------->ARR14(2)              <----------DOF2   <---------WRKY18(1)
------>AGL1                        --------->KAN1              --------->ANAC55(2)   --------->WRKY38(1)
-----LBD16                       --------->YAB1          <---------TOE2(3)           ----------->HVH21
->DOF5.7(2)    <-------GAMYB    <-------TEIL  --------->GATA12 <---------ANAC55(2)  <---------WOX13(1)
--MYB52(1)    --------->ALFIN1--------->GATA12<---------GATA12<-------TEIL         --------->GATA12
---HVH21 <---------LBD16      <---------GLK1(2)         ---------->DOF2     <---------RVE1(2) <-----
cggcaagcgtattcagggtgttagtattcttcagattcatattctctccgatttgagtctaaagttacatactttgtttgattttggattgacccatttg  26193900
                    <---------WOX13(1)             --------->MYB52(2)               --------->At4g35610
                  --------->ATHB12             <------MYB83 <---------YAB1          <---------At4g35610
     <---------TOE2(3)                         <------MYB46(1)                 <---------MYB46(3)
     <---------TOE1(3)                        <---------AtMYB61             <---------At4g35610
-------WOX13(1)  <---------YAB5               --------->MYB59    <-----------GT1 <--------P
>>>>>ARR2 --------->KAN4(2)              --------->MYB59    xxxxxxxxxxxxxxxx>smallRNA(i)
------RVE1(2)    <---------YAB1          <---------TOE2(3)  xxxxxxxxxxxxxxxx>smallRNA(s)
----YAB1 --------->KAN1 --------->AtLEC2 <---------TOE1(3) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)----
attgttttgaggttattctattgattgatgcaaatgtagtagtttaggtttggtttgtttgtgcttattgacggtcttgtgctggttagatgaattcaac  26194000
<- Previous    Next ->

AGI:  At1g69610.1   
Description:  structural constituent of ribosome. similar to structural constituent of ribosome [Arabidopsis thaliana] (TAIR:AT5G39785.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48386.1); contains InterPro domain Ribosomal protein L34e; (InterPro:IPR008195); contains InterPro domain Protein of unknown function DUF1666 (InterPro:IPR012870)
Range:  from: 26190617    to: 26193152    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At1g69620.1   
Description:  RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome. Identical to 60S ribosomal protein L34-2 (RPL34B) [Arabidopsis Thaliana] (GB:Q9FE65); similar to 60S ribosomal protein L34 (RPL34A) [Arabidopsis thaliana] (TAIR:AT1G26880.1); similar to 60S ribosomal protein L34 (GB:P41098); similar to unknown [Populus trichocarpa] (GB:ABK92764.1); similar to unknown [Populus trichocarpa] (GB:ABK94411.1); contains InterPro domain Ribosomal protein L34e; (InterPro:IPR008195)
Range:  from: 26193499    to: 26194986    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.